Mutagenetix > Incidental Mutation

Incidental Mutation 'R2865:Cic'

253160

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

040454-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R2865 (G1)

Quality Score

162

Status

Validated

Chromosome

Chromosomal Location

24967129-24993584 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24972646 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 792 (D792E)

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169266] [ENSMUST00000169392]

AlphaFold

Q924A2

Predicted Effect

probably damaging
Transcript: ENSMUST00000169266
AA Change: D792E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: D792E

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169392

SMART Domains

Protein: ENSMUSP00000131680
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC

Meta Mutation Damage Score

0.1312

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A230072I06Rik	A	G	8: 12,329,635 (GRCm39)	Q30R	unknown	Het
Bmper	A	G	9: 23,395,237 (GRCm39)	N656S	probably benign	Het
Dab1	G	A	4: 104,537,343 (GRCm39)	C192Y	probably benign	Het
Ddx6	G	T	9: 44,525,553 (GRCm39)	L103F	probably damaging	Het
Fhod1	T	C	8: 106,059,543 (GRCm39)	K714R	probably null	Het
Flt1	T	C	5: 147,531,431 (GRCm39)	Q844R	possibly damaging	Het
Fnip1	T	C	11: 54,393,250 (GRCm39)	I562T	probably damaging	Het
Fxr2	T	A	11: 69,530,253 (GRCm39)	I40N	probably damaging	Het
Gm7168	A	G	17: 14,170,117 (GRCm39)	K495E	probably benign	Het
Gria2	C	T	3: 80,639,392 (GRCm39)	V207I	probably benign	Het
Ifna6	G	C	4: 88,746,099 (GRCm39)	R149S	probably benign	Het
Ifna6	C	A	4: 88,746,086 (GRCm39)	T145K	probably benign	Het
Igf2r	T	C	17: 12,905,611 (GRCm39)	H2240R	probably damaging	Het
Ighv8-9	G	A	12: 115,432,066 (GRCm39)	P82S	probably benign	Het
Itpr3	T	C	17: 27,310,525 (GRCm39)	V436A	probably benign	Het
Ldb3	T	G	14: 34,251,460 (GRCm39)	D609A	probably damaging	Het
Lgalsl2	G	T	7: 5,362,668 (GRCm39)	D100Y	probably benign	Het
Luc7l	C	A	17: 26,485,335 (GRCm39)	Q112K	probably damaging	Het
Marchf4	C	T	1: 72,491,734 (GRCm39)	R179H	probably damaging	Het
Myt1l	A	G	12: 29,960,788 (GRCm39)	T75A	probably benign	Het
Or5t9	A	T	2: 86,659,198 (GRCm39)	D34V	probably benign	Het
Or8h10	A	T	2: 86,808,805 (GRCm39)	C112S	possibly damaging	Het
Parp4	C	T	14: 56,851,181 (GRCm39)	T728M	probably damaging	Het
Ppp1r10	A	G	17: 36,239,384 (GRCm39)	T398A	possibly damaging	Het
Ppp4c	A	T	7: 126,391,272 (GRCm39)	I20N	probably damaging	Het
Rph3a	C	T	5: 121,085,990 (GRCm39)	G482D	probably damaging	Het
Rtel1	T	A	2: 180,991,765 (GRCm39)	F388I	probably benign	Het
Slc12a6	G	A	2: 112,177,662 (GRCm39)	V594I	probably benign	Het
Slc2a4	G	A	11: 69,836,942 (GRCm39)	S134F	probably damaging	Het
Tead4	A	T	6: 128,225,062 (GRCm39)		probably null	Het
Usp40	G	A	1: 87,877,701 (GRCm39)	Q1152*	probably null	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	24,991,549 (GRCm39)	missense	probably damaging	1.00
IGL01668:Cic	APN	7	24,990,629 (GRCm39)	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	24,990,375 (GRCm39)	missense	probably damaging	0.96
IGL02506:Cic	APN	7	24,990,282 (GRCm39)	missense	probably benign
IGL02794:Cic	APN	7	24,985,069 (GRCm39)	missense	probably damaging	1.00
IGL03065:Cic	APN	7	24,985,246 (GRCm39)	splice site	probably benign
IGL03304:Cic	APN	7	24,984,274 (GRCm39)	missense	probably damaging	1.00
Capuccino	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
Cassock	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
Monkey	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R4850_Cic_466	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
1mM(1):Cic	UTSW	7	24,990,214 (GRCm39)	splice site	probably benign
IGL03046:Cic	UTSW	7	24,990,500 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0027:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0027:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0038:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0038:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0063:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0063:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0064:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0064:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0118:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0241:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0241:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0377:Cic	UTSW	7	24,985,224 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0800:Cic	UTSW	7	24,984,662 (GRCm39)	missense	probably benign
R1253:Cic	UTSW	7	24,990,373 (GRCm39)	missense	probably damaging	1.00
R1458:Cic	UTSW	7	24,979,162 (GRCm39)	intron	probably benign
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1519:Cic	UTSW	7	24,993,235 (GRCm39)	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	24,985,386 (GRCm39)	missense	probably damaging	1.00
R1824:Cic	UTSW	7	24,987,691 (GRCm39)	missense	probably damaging	1.00
R1908:Cic	UTSW	7	24,986,265 (GRCm39)	missense	probably damaging	1.00
R2045:Cic	UTSW	7	24,970,961 (GRCm39)	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	24,972,876 (GRCm39)	missense	probably damaging	0.98
R2161:Cic	UTSW	7	24,987,559 (GRCm39)	splice site	probably null
R2495:Cic	UTSW	7	24,991,201 (GRCm39)	splice site	probably benign
R3692:Cic	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
R3709:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3710:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3872:Cic	UTSW	7	24,971,124 (GRCm39)	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	24,971,771 (GRCm39)	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4426:Cic	UTSW	7	24,993,433 (GRCm39)	utr 3 prime	probably benign
R4502:Cic	UTSW	7	24,987,892 (GRCm39)	missense	probably damaging	1.00
R4585:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4586:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4614:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4664:Cic	UTSW	7	24,990,099 (GRCm39)	small deletion	probably benign
R4688:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4695:Cic	UTSW	7	24,973,013 (GRCm39)	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	24,987,908 (GRCm39)	missense	probably benign
R4746:Cic	UTSW	7	24,987,905 (GRCm39)	missense	probably damaging	1.00
R4758:Cic	UTSW	7	24,991,636 (GRCm39)	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	24,971,025 (GRCm39)	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	24,982,308 (GRCm39)	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	24,971,157 (GRCm39)	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4851:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4922:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R4989:Cic	UTSW	7	24,986,535 (GRCm39)	missense	probably damaging	1.00
R5131:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R5718:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R5801:Cic	UTSW	7	24,970,863 (GRCm39)	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	24,971,730 (GRCm39)	missense	probably damaging	1.00
R6000:Cic	UTSW	7	24,971,423 (GRCm39)	missense	probably benign	0.33
R6246:Cic	UTSW	7	24,971,067 (GRCm39)	missense	probably damaging	1.00
R6283:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R6364:Cic	UTSW	7	24,972,248 (GRCm39)	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	24,987,706 (GRCm39)	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	24,971,202 (GRCm39)	missense	probably benign	0.04
R6920:Cic	UTSW	7	24,990,107 (GRCm39)	missense	probably damaging	1.00
R6995:Cic	UTSW	7	24,970,736 (GRCm39)	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	24,971,621 (GRCm39)	missense	probably damaging	0.99
R7113:Cic	UTSW	7	24,972,869 (GRCm39)	missense	probably benign	0.08
R7560:Cic	UTSW	7	24,972,278 (GRCm39)	missense	probably damaging	0.98
R7680:Cic	UTSW	7	24,991,856 (GRCm39)	missense	probably damaging	0.96
R7698:Cic	UTSW	7	24,972,597 (GRCm39)	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	24,988,207 (GRCm39)	missense	probably damaging	1.00
R7841:Cic	UTSW	7	24,985,192 (GRCm39)	missense	probably damaging	1.00
R7879:Cic	UTSW	7	24,984,551 (GRCm39)	missense	probably benign	0.10
R7916:Cic	UTSW	7	24,987,715 (GRCm39)	missense	probably damaging	0.99
R7920:Cic	UTSW	7	24,971,384 (GRCm39)	missense	probably benign
R8056:Cic	UTSW	7	24,990,366 (GRCm39)	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	24,987,213 (GRCm39)	missense	probably damaging	1.00
R8281:Cic	UTSW	7	24,971,249 (GRCm39)	missense	probably benign
R8847:Cic	UTSW	7	24,970,631 (GRCm39)	missense	probably damaging	0.98
R8991:Cic	UTSW	7	24,988,885 (GRCm39)	missense	probably damaging	1.00
R9083:Cic	UTSW	7	24,985,470 (GRCm39)	missense	probably damaging	0.99
R9140:Cic	UTSW	7	24,985,165 (GRCm39)	missense	probably damaging	0.99
R9200:Cic	UTSW	7	24,971,940 (GRCm39)	missense	probably damaging	0.99
R9208:Cic	UTSW	7	24,987,502 (GRCm39)	missense	probably benign	0.07
R9301:Cic	UTSW	7	24,991,117 (GRCm39)	missense	probably damaging	1.00
R9408:Cic	UTSW	7	24,971,414 (GRCm39)	missense	possibly damaging	0.70
R9569:Cic	UTSW	7	24,972,120 (GRCm39)	missense	possibly damaging	0.85
R9752:Cic	UTSW	7	24,971,403 (GRCm39)	missense	probably damaging	0.96
V7732:Cic	UTSW	7	24,991,670 (GRCm39)	missense	probably benign
Z1176:Cic	UTSW	7	24,970,444 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- AGACTTCCCCAAGAGTGACAGC -3'
(R):5'- TCGGCACTAGAACTGGCAAC -3'

Sequencing Primer
(F):5'- CCAAGAGTGACAGCTTAGACTCTG -3'
(R):5'- TGGAGGCAGGCCAGGTTTC -3'

Posted On

2014-12-04