Mutagenetix > Incidental Mutation

Incidental Mutation 'R2932:Pex12'

254980

Institutional Source

Beutler Lab

Gene Symbol

Pex12

Ensembl Gene

ENSMUSG00000018733

Gene Name

peroxisomal biogenesis factor 12

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.236) question?

Stock #

R2932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83182757-83189849 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83187049 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 300 (M300L)

Ref Sequence

ENSEMBL: ENSMUSP00000135632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018877] [ENSMUST00000108146] [ENSMUST00000136369] [ENSMUST00000175741] [ENSMUST00000176518] [ENSMUST00000176944] [ENSMUST00000176374]

AlphaFold

Q8VC48

Predicted Effect

probably benign
Transcript: ENSMUST00000018877
AA Change: M300L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000018877
Gene: ENSMUSG00000018733
AA Change: M300L

Domain	Start	End	E-Value	Type
Pfam:Pex2_Pex12	26	267	3.1e-50	PFAM
RING	304	342	3.14e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083781

Predicted Effect

probably benign
Transcript: ENSMUST00000108146
AA Change: M300L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103781
Gene: ENSMUSG00000018733
AA Change: M300L

Domain	Start	End	E-Value	Type
Pfam:Pex2_Pex12	26	268	6.4e-52	PFAM
RING	304	342	3.14e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136369

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153487

Predicted Effect

probably benign
Transcript: ENSMUST00000175741
AA Change: M300L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135145
Gene: ENSMUSG00000018733
AA Change: M300L

Domain	Start	End	E-Value	Type
Pfam:Pex2_Pex12	26	268	6.4e-52	PFAM
RING	304	342	3.14e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176016

Predicted Effect

probably benign
Transcript: ENSMUST00000176518
AA Change: M300L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135632
Gene: ENSMUSG00000018733
AA Change: M300L

Domain	Start	End	E-Value	Type
Pfam:Pex2_Pex12	26	268	6.4e-52	PFAM
RING	304	342	3.14e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176545

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177533

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177150

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177248

Predicted Effect

probably benign
Transcript: ENSMUST00000176944

SMART Domains

Protein: ENSMUSP00000134798
Gene: ENSMUSG00000035152

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	199	3.4e-67	PFAM
Pfam:DNA_alkylation	18	196	4.6e-8	PFAM
Pfam:HEAT_2	88	185	3.1e-13	PFAM
Pfam:Cnd1	99	198	4.2e-27	PFAM
Pfam:HEAT	122	151	1.4e-5	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176374

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the peroxin-12 family. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of Zellweger syndrome (ZWS). [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alms1	A	G	6: 85,597,544 (GRCm39)	D1259G	possibly damaging	Het
Arpp21	T	C	9: 112,008,173 (GRCm39)	D106G	probably damaging	Het
Atp6v1a	A	G	16: 43,909,406 (GRCm39)	S542P	probably benign	Het
Ccar1	T	C	10: 62,612,538 (GRCm39)	N209S	probably benign	Het
Ccdc15	G	A	9: 37,226,954 (GRCm39)	T327I	probably benign	Het
Dhx15	G	A	5: 52,324,074 (GRCm39)	P406L	probably benign	Het
Fat3	G	A	9: 16,287,240 (GRCm39)	S761L	probably damaging	Het
Loricrin	AGCCGCCGCCGCCGCCGCCGCCGCCGCC	AGCCGCCGCCGCCGCCGCCGCCGCC	3: 91,989,185 (GRCm39)		probably benign	Het
Lrrc1	T	A	9: 77,364,721 (GRCm39)	H153L	probably benign	Het
Lrrc46	T	C	11: 96,931,935 (GRCm39)		probably benign	Het
Mrgprb2	A	G	7: 48,202,194 (GRCm39)	L177S	probably benign	Het
Mtmr2	A	T	9: 13,660,413 (GRCm39)		probably benign	Het
Mtnr1b	A	T	9: 15,785,620 (GRCm39)	V46E	probably damaging	Het
Myo5a	A	G	9: 75,103,418 (GRCm39)	E207G	possibly damaging	Het
Nalcn	A	G	14: 123,830,430 (GRCm39)	S137P	probably benign	Het
Nipal1	A	G	5: 72,824,978 (GRCm39)	I224V	possibly damaging	Het
Oas1g	T	G	5: 121,017,206 (GRCm39)	K283Q	probably benign	Het
Phldb2	A	G	16: 45,569,148 (GRCm39)	V1237A	possibly damaging	Het
Rc3h2	C	A	2: 37,268,371 (GRCm39)	V920F	probably benign	Het
Ulk1	C	T	5: 110,937,223 (GRCm39)	R691Q	probably benign	Het

Other mutations in Pex12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02992:Pex12	APN	11	83,188,753 (GRCm39)	missense	probably damaging	1.00
BB006:Pex12	UTSW	11	83,188,809 (GRCm39)	missense	probably damaging	1.00
BB016:Pex12	UTSW	11	83,188,809 (GRCm39)	missense	probably damaging	1.00
R0725:Pex12	UTSW	11	83,188,860 (GRCm39)	missense	probably damaging	0.99
R1839:Pex12	UTSW	11	83,188,648 (GRCm39)	missense	probably damaging	0.99
R2483:Pex12	UTSW	11	83,188,455 (GRCm39)	missense	possibly damaging	0.61
R5430:Pex12	UTSW	11	83,188,572 (GRCm39)	missense	probably damaging	0.96
R5526:Pex12	UTSW	11	83,187,090 (GRCm39)	missense	possibly damaging	0.62
R7135:Pex12	UTSW	11	83,188,468 (GRCm39)	missense	probably benign
R7929:Pex12	UTSW	11	83,188,809 (GRCm39)	missense	probably damaging	1.00
R9688:Pex12	UTSW	11	83,189,257 (GRCm39)	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TGGTGAGATAATGCACTAAGCTC -3'
(R):5'- GCTCTGAAGAAAGCTGTGGG -3'

Sequencing Primer
(F):5'- CTAAGCTCTTTCAGTTCTCTGGAGAG -3'
(R):5'- TCTGAAGAAAGCTGTGGGAGGTG -3'

Posted On

2014-12-29