Incidental Mutation 'R3716:Nelfcd'
ID259896
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R3716 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174423005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000016397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016397
AA Change: V179A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: V179A

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109075
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143683
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,536 L690H probably damaging Het
Acaa1b A G 9: 119,156,641 V72A probably benign Het
Actl7a T C 4: 56,744,295 L274P possibly damaging Het
Ankrd50 T C 3: 38,454,150 E433G probably damaging Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
BC055324 T C 1: 163,956,888 I779M probably damaging Het
Btbd11 C T 10: 85,561,528 H442Y probably damaging Het
Canx A G 11: 50,304,474 S256P probably benign Het
Caps2 A G 10: 112,200,732 H399R probably benign Het
Col6a6 A C 9: 105,782,174 L524R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dglucy A T 12: 100,850,116 N339I probably damaging Het
Dhrs4 G T 14: 55,478,905 M1I probably null Het
Disp1 A T 1: 183,087,751 L1035Q probably damaging Het
Ephb1 T C 9: 102,194,800 E260G probably damaging Het
Fetub T A 16: 22,935,693 C217S probably damaging Het
Frem2 T C 3: 53,572,360 S1971G probably damaging Het
Gria2 A G 3: 80,741,004 Y142H possibly damaging Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il21r A G 7: 125,632,269 K290E probably damaging Het
Inpp5f C G 7: 128,690,670 L17V probably damaging Het
Kcnh3 A G 15: 99,232,765 N421S possibly damaging Het
Krt33a A C 11: 100,014,165 C172G probably benign Het
Lrp6 A T 6: 134,507,447 H404Q probably damaging Het
Macf1 T C 4: 123,473,502 T924A probably benign Het
Mepe C A 5: 104,337,428 H145N probably benign Het
Mesp2 T G 7: 79,812,794 L366R possibly damaging Het
Mink1 T A 11: 70,607,761 L584Q probably damaging Het
Mms19 A G 19: 41,944,735 V997A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Myo15b G T 11: 115,863,413 C913F probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Obscn C T 11: 59,082,661 C2157Y probably damaging Het
Olfr1104 A T 2: 87,022,363 Y60* probably null Het
Orc1 C T 4: 108,614,459 A836V probably damaging Het
Pcdhb6 G T 18: 37,336,206 V43L probably benign Het
Prkcd G T 14: 30,599,712 D393E probably benign Het
Rb1cc1 G C 1: 6,270,690 probably null Het
Rp1 T A 1: 4,349,765 T375S probably benign Het
Slc9c1 A T 16: 45,580,219 M731L probably benign Het
Sox21 A T 14: 118,235,430 M69K probably benign Het
Spata18 A T 5: 73,666,850 probably null Het
Taok1 A G 11: 77,541,810 F726L probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Usp32 A G 11: 85,042,563 Y40H probably damaging Het
Usp37 A T 1: 74,492,986 S83T possibly damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3606:Nelfcd UTSW 2 174426544 missense probably benign 0.10
R4235:Nelfcd UTSW 2 174427048 missense probably damaging 1.00
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R4775:Nelfcd UTSW 2 174426576 missense probably damaging 0.96
R5104:Nelfcd UTSW 2 174426366 missense probably benign 0.10
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7249:Nelfcd UTSW 2 174423206 critical splice donor site probably null
R7382:Nelfcd UTSW 2 174423383 missense probably benign 0.00
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGCTTAGATGGCGCATATGC -3'
(R):5'- GACTTACTGCAAACTCAGGGAG -3'

Sequencing Primer
(F):5'- ATATGCGCTGACAGGCCTCAG -3'
(R):5'- CTGCAAACTCAGGGAGATTTTTCTC -3'
Posted On2015-01-23