Incidental Mutation 'R2905:Ttll8'
ID261633
Institutional Source Beutler Lab
Gene Symbol Ttll8
Ensembl Gene ENSMUSG00000022388
Gene Nametubulin tyrosine ligase-like family, member 8
Synonyms1700019P01Rik
MMRRC Submission 040492-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R2905 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location88890633-88954418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88914477 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 685 (M685K)
Ref Sequence ENSEMBL: ENSMUSP00000104996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109371] [ENSMUST00000177180]
Predicted Effect probably benign
Transcript: ENSMUST00000109371
AA Change: M685K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104996
Gene: ENSMUSG00000022388
AA Change: M685K

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
Pfam:TTL 324 621 3.9e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137740
Predicted Effect probably benign
Transcript: ENSMUST00000177180
SMART Domains Protein: ENSMUSP00000135381
Gene: ENSMUSG00000022388

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177254
Meta Mutation Damage Score 0.0372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010109I03Rik T A 15: 74,879,867 Y106F probably benign Het
2310035C23Rik T C 1: 105,691,994 V316A probably benign Het
Ajap1 C A 4: 153,432,827 R19L probably benign Het
Alk A C 17: 71,985,494 S496R probably benign Het
Arhgap15 T C 2: 44,063,786 F175L probably damaging Het
Col12a1 G T 9: 79,652,025 S1860R probably damaging Het
Cuedc2 C T 19: 46,332,649 V15I probably benign Het
Dennd3 T A 15: 73,557,646 L4Q probably damaging Het
Dusp8 T A 7: 142,083,389 K234* probably null Het
Dzip1l A G 9: 99,663,669 E657G probably damaging Het
F7 C T 8: 13,034,775 T267I probably benign Het
Gm9791 T C 3: 34,005,187 noncoding transcript Het
Hmcn1 A G 1: 150,749,035 S1040P probably damaging Het
Jtb C G 3: 90,232,492 P62R probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ly75 A G 2: 60,334,554 V760A probably benign Het
Nudt4 T G 10: 95,563,709 K17Q probably benign Het
Olfr815 T C 10: 129,902,400 I103M possibly damaging Het
Pde4a A T 9: 21,201,349 T274S probably benign Het
Pou6f1 C T 15: 100,585,958 V220I probably benign Het
Rif1 T C 2: 52,098,504 S752P probably damaging Het
Ror2 A G 13: 53,131,995 I73T probably benign Het
Samhd1 A T 2: 157,123,415 F160Y possibly damaging Het
Tas2r118 A G 6: 23,969,802 F87L possibly damaging Het
Thop1 T C 10: 81,079,591 L295P probably damaging Het
Tlr12 A G 4: 128,616,009 M816T probably damaging Het
Trip12 T C 1: 84,754,343 N970S probably benign Het
Ttc26 T C 6: 38,401,102 V283A possibly damaging Het
Ushbp1 G A 8: 71,387,535 R491* probably null Het
Other mutations in Ttll8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ttll8 APN 15 88914153 missense probably benign
IGL00895:Ttll8 APN 15 88933528 missense probably damaging 1.00
IGL01061:Ttll8 APN 15 88917250 missense possibly damaging 0.85
IGL01661:Ttll8 APN 15 88935999 splice site probably benign
IGL01992:Ttll8 APN 15 88915645 missense possibly damaging 0.48
IGL02212:Ttll8 APN 15 88917247 missense probably benign 0.04
IGL02234:Ttll8 APN 15 88914049 missense possibly damaging 0.53
IGL02569:Ttll8 APN 15 88933926 nonsense probably null
IGL02935:Ttll8 APN 15 88914556 missense probably benign 0.10
IGL03064:Ttll8 APN 15 88919594 missense probably benign 0.22
R0969:Ttll8 UTSW 15 88933935 missense probably damaging 1.00
R1637:Ttll8 UTSW 15 88914444 missense probably benign 0.12
R1939:Ttll8 UTSW 15 88915486 missense probably damaging 1.00
R1992:Ttll8 UTSW 15 88914451 missense probably benign 0.00
R2173:Ttll8 UTSW 15 88914597 missense probably damaging 1.00
R2201:Ttll8 UTSW 15 88933953 missense possibly damaging 0.57
R2414:Ttll8 UTSW 15 88936133 splice site probably benign
R4159:Ttll8 UTSW 15 88917241 missense probably benign 0.00
R4368:Ttll8 UTSW 15 88914181 missense possibly damaging 0.88
R4395:Ttll8 UTSW 15 88915580 missense possibly damaging 0.80
R4707:Ttll8 UTSW 15 88917090 missense probably damaging 0.99
R4926:Ttll8 UTSW 15 88914165 missense probably damaging 0.98
R4983:Ttll8 UTSW 15 88925582 missense probably benign 0.08
R5698:Ttll8 UTSW 15 88939006 missense possibly damaging 0.85
R5752:Ttll8 UTSW 15 88932728 missense probably benign 0.00
R5834:Ttll8 UTSW 15 88917246 missense possibly damaging 0.48
R5889:Ttll8 UTSW 15 88933939 missense probably damaging 1.00
R6528:Ttll8 UTSW 15 88914238 missense probably benign 0.03
R6931:Ttll8 UTSW 15 88914304 missense possibly damaging 0.55
R7133:Ttll8 UTSW 15 88915427 missense probably damaging 0.99
R7268:Ttll8 UTSW 15 88934956 critical splice donor site probably null
R7286:Ttll8 UTSW 15 88917239 missense probably benign 0.01
X0058:Ttll8 UTSW 15 88917130 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTACCCCTGGGACTTTACTG -3'
(R):5'- ACAGGCTATCTCTTCTCACAGC -3'

Sequencing Primer
(F):5'- ATTGGACTCTGGTATAACCGC -3'
(R):5'- TTCTCACAGCCTGCCGTGG -3'
Posted On2015-01-23