Mutagenetix > Incidental Mutation

Incidental Mutation 'R2907:Psmd4'

261681

Institutional Source

Beutler Lab

Gene Symbol

Psmd4

Ensembl Gene

ENSMUSG00000005625

Gene Name

proteasome (prosome, macropain) 26S subunit, non-ATPase, 4

Synonyms

angiocidin, Mcb1, Af1, multiubiquitin-chain-binding protein

MMRRC Submission

040494-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2907 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

94939999-94949880 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 94941273 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 55 (A55E)

Ref Sequence

ENSEMBL: ENSMUSP00000114545 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071664] [ENSMUST00000107237] [ENSMUST00000117355] [ENSMUST00000140348]

AlphaFold

O35226

Predicted Effect

probably benign
Transcript: ENSMUST00000071664
AA Change: A240E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000071589
Gene: ENSMUSG00000005625
AA Change: A240E

Domain	Start	End	E-Value	Type
VWA	2	188	7.38e-12	SMART
low complexity region	189	201	N/A	INTRINSIC
UIM	211	230	2.04e0	SMART
UIM	285	304	1.49e-2	SMART
low complexity region	307	320	N/A	INTRINSIC
low complexity region	367	379	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107237
AA Change: A240E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000102857
Gene: ENSMUSG00000005625
AA Change: A240E

Domain	Start	End	E-Value	Type
VWA	2	188	7.38e-12	SMART
low complexity region	189	201	N/A	INTRINSIC
UIM	211	230	2.04e0	SMART
UIM	282	301	1.49e-2	SMART
low complexity region	304	317	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117355
AA Change: A240E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000113554
Gene: ENSMUSG00000005625
AA Change: A240E

Domain	Start	End	E-Value	Type
VWA	2	188	7.38e-12	SMART
low complexity region	189	201	N/A	INTRINSIC
UIM	211	230	2.04e0	SMART
UIM	285	304	1.49e-2	SMART
low complexity region	307	320	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140280

Predicted Effect

probably damaging
Transcript: ENSMUST00000140348
AA Change: A55E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114545
Gene: ENSMUSG00000005625
AA Change: A55E

Domain	Start	End	E-Value	Type
Pfam:UIM	34	42	2.4e-3	PFAM
UIM	100	119	1.49e-2	SMART
low complexity region	122	135	N/A	INTRINSIC
low complexity region	182	194	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143688

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147960

Meta Mutation Damage Score

0.0710

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality and abnormal embryogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	A	G	5: 137,565,559 (GRCm39)	E385G	probably damaging	Het
Adam32	A	T	8: 25,353,520 (GRCm39)	W690R	probably damaging	Het
Ap1b1	T	A	11: 4,981,641 (GRCm39)	N516K	probably damaging	Het
Arap3	G	A	18: 38,123,580 (GRCm39)	P452L	possibly damaging	Het
Armcx6	A	T	X: 133,650,199 (GRCm39)	C211S	probably damaging	Het
Asns	A	G	6: 7,675,506 (GRCm39)	S499P	probably benign	Het
Aspn	G	T	13: 49,705,374 (GRCm39)	V79F	probably damaging	Het
Astn2	A	G	4: 65,563,093 (GRCm39)	I844T	possibly damaging	Het
Asxl3	A	T	18: 22,650,330 (GRCm39)	H773L	possibly damaging	Het
Atp7b	G	A	8: 22,501,570 (GRCm39)	T781I	probably damaging	Het
Bcl6	G	A	16: 23,786,869 (GRCm39)	R641W	probably damaging	Het
Csmd3	T	A	15: 47,874,449 (GRCm39)	I612F	probably damaging	Het
Dnm1l	A	T	16: 16,132,175 (GRCm39)	S666T	probably damaging	Het
Gucy2c	A	T	6: 136,685,385 (GRCm39)	V852E	probably damaging	Het
H2-T3	G	A	17: 36,498,347 (GRCm39)	R233C	possibly damaging	Het
Igfbp4	A	G	11: 98,932,377 (GRCm39)		probably benign	Het
Igkv16-104	T	C	6: 68,402,911 (GRCm39)	I68T	probably damaging	Het
Kansl1	T	A	11: 104,315,286 (GRCm39)	S251C	possibly damaging	Het
Kcnk1	G	T	8: 126,722,538 (GRCm39)	V114L	probably benign	Het
Klra3	G	T	6: 130,310,302 (GRCm39)	Q73K	probably damaging	Het
Mcpt1	T	C	14: 56,257,580 (GRCm39)	V242A	probably damaging	Het
Nek10	C	A	14: 14,980,613 (GRCm38)	Q990K	possibly damaging	Het
Nlrp4d	A	T	7: 10,112,354 (GRCm39)	V605E	probably benign	Het
Or10w1	C	T	19: 13,632,611 (GRCm39)	P268S	possibly damaging	Het
Or5an1b	T	C	19: 12,300,032 (GRCm39)	D53G	probably damaging	Het
Or5d46	T	C	2: 88,170,827 (GRCm39)	I306T	probably benign	Het
Osbpl1a	A	G	18: 13,004,129 (GRCm39)		probably benign	Het
Otud4	T	A	8: 80,399,697 (GRCm39)	S803T	probably benign	Het
Pax9	C	T	12: 56,756,529 (GRCm39)	T289I	probably benign	Het
Pcdha5	A	C	18: 37,093,868 (GRCm39)	I126L	possibly damaging	Het
Rab36	G	A	10: 74,880,328 (GRCm39)	V63I	probably damaging	Het
Rbm26	T	A	14: 105,380,270 (GRCm39)	T516S	probably benign	Het
Sdr42e1	G	A	8: 118,389,511 (GRCm39)	L377F	probably damaging	Het
Setdb1	T	C	3: 95,234,512 (GRCm39)		probably benign	Het
Uba3	T	C	6: 97,180,514 (GRCm39)	E21G	probably benign	Het
Uggt2	C	T	14: 119,256,919 (GRCm39)	S1105N	probably benign	Het
Zfp113	T	C	5: 138,143,219 (GRCm39)	N344D	probably benign	Het
Zfp738	T	C	13: 67,818,231 (GRCm39)	I587V	probably benign	Het

Other mutations in Psmd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02396:Psmd4	APN	3	94,943,221 (GRCm39)	missense	probably damaging	1.00
R0173:Psmd4	UTSW	3	94,940,234 (GRCm39)	missense	probably damaging	1.00
R1962:Psmd4	UTSW	3	94,944,012 (GRCm39)	missense	possibly damaging	0.89
R3781:Psmd4	UTSW	3	94,944,039 (GRCm39)	missense	probably benign	0.09
R3783:Psmd4	UTSW	3	94,942,562 (GRCm39)	missense	possibly damaging	0.85
R4902:Psmd4	UTSW	3	94,943,170 (GRCm39)	missense	probably damaging	0.98
R5090:Psmd4	UTSW	3	94,942,559 (GRCm39)	missense	possibly damaging	0.53
R8031:Psmd4	UTSW	3	94,943,203 (GRCm39)	missense	probably damaging	1.00
R9221:Psmd4	UTSW	3	94,942,604 (GRCm39)	missense	probably damaging	1.00
R9312:Psmd4	UTSW	3	94,940,729 (GRCm39)	missense	probably benign	0.00
R9428:Psmd4	UTSW	3	94,940,767 (GRCm39)	missense	probably benign	0.00
R9464:Psmd4	UTSW	3	94,940,735 (GRCm39)	missense	probably benign	0.02
X0024:Psmd4	UTSW	3	94,944,028 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACCTAGTAGATATTCCACAGGGC -3'
(R):5'- ATACCACAGCATCGACTGTG -3'

Sequencing Primer
(F):5'- TAGATATTCCACAGGGCTGGCC -3'
(R):5'- GGGCATCAGATCTCATTACAGATG -3'

Posted On

2015-01-23