Incidental Mutation 'R3111:Syce1l'
ID263773
Institutional Source Beutler Lab
Gene Symbol Syce1l
Ensembl Gene ENSMUSG00000033409
Gene Namesynaptonemal complex central element protein 1 like
Synonyms4930481F22Rik, mmrp2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3111 ()
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location113643213-113655533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113654947 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 164 (Q164R)
Ref Sequence ENSEMBL: ENSMUSP00000148356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034219] [ENSMUST00000095173] [ENSMUST00000212269]
Predicted Effect silent
Transcript: ENSMUST00000034219
SMART Domains Protein: ENSMUSP00000034219
Gene: ENSMUSG00000033409

DomainStartEndE-ValueType
Pfam:SYCE1 45 135 4.4e-39 PFAM
low complexity region 139 154 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095173
AA Change: Q185R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092796
Gene: ENSMUSG00000033409
AA Change: Q185R

DomainStartEndE-ValueType
Pfam:SYCE1 45 172 8.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212017
Predicted Effect probably benign
Transcript: ENSMUST00000212269
AA Change: Q164R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 98.4%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T A 11: 110,178,829 K1554* probably null Het
Car12 C T 9: 66,753,726 T124I probably damaging Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Disp1 A T 1: 183,087,523 M1111K probably damaging Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gad1-ps A G 10: 99,444,521 noncoding transcript Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Mfap3 T C 11: 57,529,580 V129A probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Myh4 T A 11: 67,246,450 L499Q possibly damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nmnat3 T A 9: 98,399,480 I45N probably damaging Het
Olfr392 T C 11: 73,814,186 R299G probably benign Het
Osbpl9 T C 4: 109,083,093 I232V probably benign Het
Pcdha12 A T 18: 37,022,190 H654L probably damaging Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pds5b T C 5: 150,719,907 S65P probably damaging Het
Pgm2 C T 4: 99,956,025 T11I probably benign Het
Phf24 G A 4: 42,938,316 V226I probably benign Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plekhh3 T C 11: 101,164,147 probably benign Het
Ptprf T C 4: 118,211,432 D1713G probably damaging Het
Rbp3 G T 14: 33,954,112 V6F probably benign Het
Sac3d1 T C 19: 6,118,357 K77R probably benign Het
Slc1a6 T A 10: 78,789,081 S107T probably damaging Het
Tgfbi T C 13: 56,609,734 Y30H probably damaging Het
Tmem217 A T 17: 29,526,558 V66D probably damaging Het
Tnn C A 1: 160,107,055 D1263Y probably damaging Het
Ylpm1 T C 12: 85,029,371 F499L probably damaging Het
Other mutations in Syce1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Syce1l APN 8 113649502 missense probably damaging 0.99
IGL00783:Syce1l APN 8 113652862 missense probably benign 0.23
IGL00784:Syce1l APN 8 113652862 missense probably benign 0.23
IGL02748:Syce1l APN 8 113655465 utr 3 prime probably benign
IGL03003:Syce1l APN 8 113654067 missense probably damaging 0.99
R0101:Syce1l UTSW 8 113655429 missense probably benign 0.41
R0486:Syce1l UTSW 8 113654763 critical splice acceptor site probably null
R0492:Syce1l UTSW 8 113654068 missense possibly damaging 0.86
R1709:Syce1l UTSW 8 113654030 critical splice acceptor site probably null
R1783:Syce1l UTSW 8 113654834 missense possibly damaging 0.66
R2307:Syce1l UTSW 8 113643305 critical splice donor site probably null
R3110:Syce1l UTSW 8 113654947 missense probably benign
R3112:Syce1l UTSW 8 113654947 missense probably benign
R3790:Syce1l UTSW 8 113643265 missense possibly damaging 0.63
R5112:Syce1l UTSW 8 113651642 missense probably damaging 0.99
R5398:Syce1l UTSW 8 113652513 missense probably damaging 1.00
R6373:Syce1l UTSW 8 113649511 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATCCTGACAGGTCCTGC -3'
(R):5'- ATTCTGAGCTTCTGGGCTGC -3'

Sequencing Primer
(F):5'- TGACAGGTCCTGCAGCAG -3'
(R):5'- GGACTGCCCCTCCAATTC -3'
Posted On2015-02-05