Mutagenetix > Incidental Mutation

Incidental Mutation 'R2939:Smc1a'

264611

Institutional Source

Beutler Lab

Gene Symbol

Smc1a

Ensembl Gene

ENSMUSG00000041133

Gene Name

structural maintenance of chromosomes 1A

Synonyms

Smc1l1, Smc1, SB1.8, 5830426I24Rik, Smc1alpha, SMCB

MMRRC Submission

040516-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R2939 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

150799386-150844969 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 150816695 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 516 (Y516N)

Ref Sequence

ENSEMBL: ENSMUSP00000044645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045312] [ENSMUST00000145518]

AlphaFold

Q9CU62

PDB Structure

SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045312
AA Change: Y516N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044645
Gene: ENSMUSG00000041133
AA Change: Y516N

Domain	Start	End	E-Value	Type
Pfam:AAA_29	4	57	6.7e-10	PFAM
Pfam:AAA_23	7	299	8.3e-15	PFAM
low complexity region	347	361	N/A	INTRINSIC
SMC_hinge	513	629	5.39e-34	SMART
low complexity region	673	687	N/A	INTRINSIC
low complexity region	951	967	N/A	INTRINSIC
low complexity region	1045	1061	N/A	INTRINSIC
PDB:1W1W\|D	1062	1223	2e-40	PDB
Blast:AAA	1070	1222	3e-25	BLAST
SCOP:d1e69a_	1119	1208	5e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135172

Predicted Effect

probably benign
Transcript: ENSMUST00000145518

SMART Domains

Protein: ENSMUSP00000138113
Gene: ENSMUSG00000041133

Domain	Start	End	E-Value	Type
Pfam:SMC_N	3	43	6.1e-14	PFAM

Meta Mutation Damage Score

0.7968

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased chromosomal instability, decreased cell survival, and defective S-phase checkpoint after ionizing radiation exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl11	T	C	9: 107,808,409 (GRCm39)	Y911H	possibly damaging	Het
Arhgef26	A	C	3: 62,288,331 (GRCm39)	K467T	possibly damaging	Het
Armcx6	A	T	X: 133,650,625 (GRCm39)	W69R	probably damaging	Het
Asl	T	C	5: 130,042,245 (GRCm39)	Y277C	probably damaging	Het
Atm	T	C	9: 53,406,011 (GRCm39)	Y1219C	probably damaging	Het
Azin2	C	T	4: 128,828,397 (GRCm39)	C270Y	probably benign	Het
Brsk1	A	T	7: 4,711,139 (GRCm39)	I545F	possibly damaging	Het
Carm1	C	A	9: 21,490,692 (GRCm39)		probably null	Het
Cfap410	A	G	10: 77,817,507 (GRCm39)	N78S	probably benign	Het
Cfap69	G	A	5: 5,694,432 (GRCm39)	A143V	probably damaging	Het
Cldn14	T	C	16: 93,716,192 (GRCm39)	K218R	probably damaging	Het
Col5a3	T	C	9: 20,706,954 (GRCm39)	K714R	unknown	Het
Crybg2	A	G	4: 133,809,745 (GRCm39)	H1517R	possibly damaging	Het
Dagla	A	C	19: 10,233,728 (GRCm39)	F382C	probably damaging	Het
Dixdc1	G	A	9: 50,622,259 (GRCm39)	A25V	probably damaging	Het
Dock6	A	G	9: 21,750,496 (GRCm39)	F473L	possibly damaging	Het
Eif5	T	C	12: 111,506,713 (GRCm39)	C102R	probably damaging	Het
Faiml	A	G	9: 99,114,527 (GRCm39)	C121R	probably damaging	Het
Fhdc1	A	G	3: 84,364,577 (GRCm39)	V223A	possibly damaging	Het
Garin4	T	C	1: 190,896,103 (GRCm39)	D180G	possibly damaging	Het
Gpatch8	A	G	11: 102,399,010 (GRCm39)	V74A	unknown	Het
Haghl	A	G	17: 26,004,060 (GRCm39)	V8A	possibly damaging	Het
Ksr1	A	G	11: 78,936,007 (GRCm39)		probably null	Het
Lama5	A	C	2: 179,840,747 (GRCm39)	Y584D	probably damaging	Het
Lgi4	C	T	7: 30,767,253 (GRCm39)	R427*	probably null	Het
Lrriq1	T	A	10: 102,980,750 (GRCm39)	S1462C	probably damaging	Het
Map3k4	C	T	17: 12,480,157 (GRCm39)	E682K	probably damaging	Het
Myo9b	G	A	8: 71,786,981 (GRCm39)	R721Q	probably benign	Het
Nherf1	C	T	11: 115,071,270 (GRCm39)	R335C	probably damaging	Het
Nmnat2	C	A	1: 152,950,474 (GRCm39)	S53Y	probably damaging	Het
Or8b12i	C	A	9: 20,082,061 (GRCm39)	G269W	probably benign	Het
Or8g34	G	A	9: 39,373,226 (GRCm39)	M166I	probably benign	Het
Pcsk7	C	T	9: 45,827,322 (GRCm39)	A363V	probably damaging	Het
Pdrg1	C	T	2: 152,854,355 (GRCm39)	G62R	probably damaging	Het
Pdzd7	A	G	19: 45,033,862 (GRCm39)	I74T	possibly damaging	Het
Plcb4	T	C	2: 135,781,123 (GRCm39)		probably benign	Het
Pramel28	A	G	4: 143,693,247 (GRCm39)	V77A	probably benign	Het
Rnf25	A	G	1: 74,635,047 (GRCm39)	V135A	possibly damaging	Het
Rph3a	A	G	5: 121,118,212 (GRCm39)		probably benign	Het
Rsf1	CG	CGACGGCGGTG	7: 97,229,115 (GRCm39)		probably benign	Het
Senp6	G	A	9: 80,051,124 (GRCm39)	A1134T	probably benign	Het
Slc1a6	G	T	10: 78,650,448 (GRCm39)	*562L	probably null	Het
Slc26a6	G	A	9: 108,734,236 (GRCm39)	V206I	probably benign	Het
Slc45a3	A	G	1: 131,905,637 (GRCm39)	E206G	probably damaging	Het
Smpd3	A	G	8: 106,984,039 (GRCm39)	V560A	probably benign	Het
Spata31g1	A	G	4: 42,972,946 (GRCm39)	K760E	probably benign	Het
Ssc4d	T	C	5: 135,994,578 (GRCm39)	T51A	possibly damaging	Het
Suco	A	G	1: 161,676,220 (GRCm39)	I386T	probably damaging	Het
Tecta	A	T	9: 42,289,290 (GRCm39)	M425K	possibly damaging	Het
Tmprss11e	G	A	5: 86,869,266 (GRCm39)	R96W	probably damaging	Het
Trim63	T	C	4: 134,050,308 (GRCm39)		probably benign	Het
Trpv1	A	G	11: 73,145,675 (GRCm39)	K403R	probably damaging	Het
Ttc39d	A	G	17: 80,524,982 (GRCm39)	Y547C	probably damaging	Het
Unc79	C	T	12: 102,957,684 (GRCm39)	T33I	probably damaging	Het
Usp47	G	A	7: 111,681,743 (GRCm39)	S518N	probably damaging	Het
Vmn2r22	T	A	6: 123,614,594 (GRCm39)	D332V	probably damaging	Het
Vmn2r55	A	G	7: 12,385,832 (GRCm39)	L716P	probably damaging	Het
Zfp558	T	C	9: 18,367,924 (GRCm39)	N288S	possibly damaging	Het

Other mutations in Smc1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01621:Smc1a	APN	X	150,819,125 (GRCm39)	missense	probably damaging	1.00
IGL02385:Smc1a	APN	X	150,820,655 (GRCm39)	missense	possibly damaging	0.67
R2421:Smc1a	UTSW	X	150,830,971 (GRCm39)	splice site	probably benign
R2422:Smc1a	UTSW	X	150,830,971 (GRCm39)	splice site	probably benign
R2940:Smc1a	UTSW	X	150,816,695 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTCTTCCATCTTTTAACATGTTTAT -3'
(R):5'- AGGCAAGAAGGTCTCAGGCTC -3'

Sequencing Primer
(F):5'- GCCAAACTTCTATCTTTGGAAGGAGC -3'
(R):5'- AGAAGGTCTCAGGCTCTCCAC -3'

Posted On

2015-02-05