Incidental Mutation 'R3056:Vmn2r110'
ID265190
Institutional Source Beutler Lab
Gene Symbol Vmn2r110
Ensembl Gene ENSMUSG00000091259
Gene Namevomeronasal 2, receptor 110
SynonymsEG224582
MMRRC Submission 040565-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R3056 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20573829-20596259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20583098 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 405 (Y405F)
Ref Sequence ENSEMBL: ENSMUSP00000129347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169559]
Predicted Effect probably damaging
Transcript: ENSMUST00000169559
AA Change: Y405F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259
AA Change: Y405F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,457,283 probably null Het
2410015M20Rik A G 17: 56,608,889 F55S probably damaging Het
2410089E03Rik T C 15: 8,251,007 S2805P unknown Het
Abca1 A T 4: 53,127,626 M131K probably benign Het
Agbl1 C T 7: 76,766,484 T751M possibly damaging Het
Asb14 A G 14: 26,914,189 I510V possibly damaging Het
Bard1 A G 1: 71,088,231 V73A possibly damaging Het
C6 T C 15: 4,739,873 I187T probably damaging Het
Catsper3 T C 13: 55,808,896 S376P unknown Het
Ccdc150 A G 1: 54,288,842 N361S possibly damaging Het
Cntn5 A G 9: 10,419,071 L7P probably benign Het
Cxcr6 A T 9: 123,810,464 I177F probably damaging Het
Dnah7b A G 1: 46,268,709 D3061G possibly damaging Het
Epas1 T C 17: 86,830,981 F835S probably damaging Het
Fat3 C T 9: 15,960,496 R3533H probably benign Het
Fxr1 A G 3: 34,049,184 E221G probably damaging Het
Gm436 A G 4: 144,674,698 I72T probably benign Het
Gpatch11 A G 17: 78,843,843 T228A probably damaging Het
Greb1 G T 12: 16,688,591 T1457K probably damaging Het
Ighm T A 12: 113,418,976 probably benign Het
Ints12 G A 3: 133,109,365 M444I possibly damaging Het
Lmx1b G A 2: 33,567,285 Q168* probably null Het
Ltbp3 C A 19: 5,751,406 N659K probably benign Het
Mrpl20 G T 4: 155,803,872 V43F possibly damaging Het
Nlgn1 T C 3: 25,433,696 N825S possibly damaging Het
Olfr1087 C A 2: 86,690,552 C141F possibly damaging Het
Olfr1163 T A 2: 88,071,239 T48S probably benign Het
Olfr492 A T 7: 108,323,550 V42E possibly damaging Het
Pccb C T 9: 101,030,197 R79Q probably damaging Het
Peg10 G A 6: 4,755,029 R270H possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc4a4 T C 5: 89,225,948 V971A probably damaging Het
Timm29 T C 9: 21,593,591 M185T probably damaging Het
Tmem92 C T 11: 94,779,047 C86Y probably benign Het
Tnfrsf8 C T 4: 145,285,325 probably null Het
Tnks1bp1 T A 2: 85,070,000 C1433* probably null Het
Utp14b T A 1: 78,664,725 D113E possibly damaging Het
Wiz A G 17: 32,357,697 S628P probably benign Het
Xrcc4 T C 13: 90,062,077 T83A probably benign Het
Other mutations in Vmn2r110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Vmn2r110 APN 17 20583627 missense probably benign 0.01
IGL01824:Vmn2r110 APN 17 20574667 missense probably benign 0.44
IGL01879:Vmn2r110 APN 17 20573860 missense probably benign 0.01
IGL02168:Vmn2r110 APN 17 20583800 splice site probably benign
IGL02178:Vmn2r110 APN 17 20584444 splice site probably null
IGL02322:Vmn2r110 APN 17 20573935 missense probably damaging 1.00
IGL02323:Vmn2r110 APN 17 20596137 missense probably damaging 0.98
IGL02415:Vmn2r110 APN 17 20583771 missense probably benign 0.03
IGL02491:Vmn2r110 APN 17 20596138 missense probably damaging 0.99
IGL02876:Vmn2r110 APN 17 20574296 missense probably damaging 0.98
IGL03141:Vmn2r110 APN 17 20583714 missense possibly damaging 0.79
IGL03270:Vmn2r110 APN 17 20583516 missense probably benign 0.00
IGL03286:Vmn2r110 APN 17 20584206 missense possibly damaging 0.95
IGL03379:Vmn2r110 APN 17 20583644 missense probably damaging 0.99
PIT4243001:Vmn2r110 UTSW 17 20582117 missense probably benign 0.01
R0040:Vmn2r110 UTSW 17 20596084 missense probably benign 0.10
R0195:Vmn2r110 UTSW 17 20574055 missense probably benign 0.31
R0716:Vmn2r110 UTSW 17 20573903 missense probably damaging 0.99
R1199:Vmn2r110 UTSW 17 20583263 missense probably benign 0.03
R1767:Vmn2r110 UTSW 17 20580578 missense possibly damaging 0.83
R2212:Vmn2r110 UTSW 17 20573947 unclassified probably null
R4093:Vmn2r110 UTSW 17 20583380 missense possibly damaging 0.83
R4418:Vmn2r110 UTSW 17 20583689 nonsense probably null
R4598:Vmn2r110 UTSW 17 20583767 nonsense probably null
R4754:Vmn2r110 UTSW 17 20596196 missense probably benign 0.00
R5283:Vmn2r110 UTSW 17 20580637 missense probably benign 0.00
R5421:Vmn2r110 UTSW 17 20583620 missense probably damaging 1.00
R5672:Vmn2r110 UTSW 17 20596232 missense probably benign
R5865:Vmn2r110 UTSW 17 20584295 missense probably benign 0.00
R6642:Vmn2r110 UTSW 17 20583517 missense possibly damaging 0.94
R6799:Vmn2r110 UTSW 17 20583536 missense probably benign
R7167:Vmn2r110 UTSW 17 20574179 missense probably benign 0.01
R7291:Vmn2r110 UTSW 17 20574209 missense probably benign 0.13
R7320:Vmn2r110 UTSW 17 20596054 missense probably benign
Z1088:Vmn2r110 UTSW 17 20583680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATACCTACCTTGCTGTCATTGC -3'
(R):5'- ATGTTTGACTCTTTCCATGGTAGCC -3'

Sequencing Primer
(F):5'- TGCAGAACTCATATATCAGGGTGCTG -3'
(R):5'- TACCCACAAGTATAGAGAGAGCTTTG -3'
Posted On2015-02-05