Incidental Mutation 'R3610:Kremen1'
List |< first << previous [record 9 of 20] next >> last >|
ID269207
Institutional Source Beutler Lab
Gene Symbol Kremen1
Ensembl Gene ENSMUSG00000020393
Gene Namekringle containing transmembrane protein 1
SynonymsKrm1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3610 (G1)
Quality Score166
Status Not validated
Chromosome11
Chromosomal Location5191552-5261558 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) CGGG to CGGGGGG at 5201791 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000020662]
Predicted Effect probably benign
Transcript: ENSMUST00000020662
SMART Domains Protein: ENSMUSP00000020662
Gene: ENSMUSG00000020393

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KR 30 116 9.81e-23 SMART
Pfam:WSC 119 200 3.7e-21 PFAM
CUB 214 321 4.27e-19 SMART
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151978
SMART Domains Protein: ENSMUSP00000121252
Gene: ENSMUSG00000020393

DomainStartEndE-ValueType
Pfam:WSC 17 98 2.3e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high-affinity dickkopf homolog 1 (DKK1) transmembrane receptor that functionally cooperates with DKK1 to block wingless (WNT)/beta-catenin signaling. The encoded protein is a component of a membrane complex that modulates canonical WNT signaling through lipoprotein receptor-related protein 6 (LRP6). It contains extracellular kringle, WSC, and CUB domains. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 C A 11: 94,561,346 V457L probably benign Het
Cacna1a C A 8: 84,559,065 R733S probably damaging Het
Cc2d2a A T 5: 43,712,326 E856D probably damaging Het
Cpeb2 T C 5: 43,285,933 F989S probably damaging Het
Dcaf10 G T 4: 45,372,962 E409* probably null Het
Ddx3y T C Y: 1,263,928 N545S probably null Het
Eef2k A G 7: 120,889,235 S448G probably benign Het
Irf2bpl T C 12: 86,881,857 I681V probably benign Het
Morc2b A G 17: 33,136,278 V840A probably damaging Het
Rcl1 A G 19: 29,118,230 T72A probably benign Het
Robo1 T C 16: 72,983,770 F796S probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Tars T C 15: 11,392,904 Y152C probably damaging Het
Tmem184a A G 5: 139,807,955 probably null Het
Tmem8 G A 17: 26,118,886 V415I probably benign Het
Tsc2 A C 17: 24,622,550 I365S possibly damaging Het
Usp17la G A 7: 104,861,072 V295I probably damaging Het
Vim A T 2: 13,578,626 H253L possibly damaging Het
Other mutations in Kremen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Kremen1 APN 11 5199667 missense probably benign 0.00
R0038:Kremen1 UTSW 11 5207703 splice site probably benign
R0511:Kremen1 UTSW 11 5215447 missense probably damaging 1.00
R1557:Kremen1 UTSW 11 5215373 intron probably null
R1579:Kremen1 UTSW 11 5201791 unclassified probably benign
R1729:Kremen1 UTSW 11 5201791 unclassified probably benign
R1784:Kremen1 UTSW 11 5201792 unclassified probably benign
R1800:Kremen1 UTSW 11 5201791 unclassified probably benign
R2079:Kremen1 UTSW 11 5201794 frame shift probably null
R2100:Kremen1 UTSW 11 5201788 unclassified probably benign
R2286:Kremen1 UTSW 11 5201791 unclassified probably benign
R2298:Kremen1 UTSW 11 5201788 unclassified probably benign
R2352:Kremen1 UTSW 11 5201791 unclassified probably benign
R2512:Kremen1 UTSW 11 5201791 unclassified probably benign
R2761:Kremen1 UTSW 11 5201792 unclassified probably benign
R2846:Kremen1 UTSW 11 5201793 unclassified probably benign
R2882:Kremen1 UTSW 11 5201791 unclassified probably benign
R2944:Kremen1 UTSW 11 5201791 unclassified probably benign
R2980:Kremen1 UTSW 11 5201794 unclassified probably benign
R3151:Kremen1 UTSW 11 5195012 missense probably damaging 0.99
R3831:Kremen1 UTSW 11 5201794 unclassified probably benign
R3957:Kremen1 UTSW 11 5201791 unclassified probably benign
R4231:Kremen1 UTSW 11 5243881 nonsense probably null
R4397:Kremen1 UTSW 11 5199610 missense probably benign 0.36
R5627:Kremen1 UTSW 11 5199709 missense probably benign 0.01
R6818:Kremen1 UTSW 11 5195051 missense probably benign 0.02
T0975:Kremen1 UTSW 11 5195105 missense probably benign 0.02
Y4339:Kremen1 UTSW 11 5201791 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGAAATGATCTGTAGCTGAGTCAGG -3'
(R):5'- TGACTTCCCTGACACCTACG -3'

Sequencing Primer
(F):5'- TCAGGAGGACCAAGTGTGCC -3'
(R):5'- TGACACCTACGCCACTGG -3'
Posted On2015-02-19