Incidental Mutation 'R3738:Trim9'
ID270251
Institutional Source Beutler Lab
Gene Symbol Trim9
Ensembl Gene ENSMUSG00000021071
Gene Nametripartite motif-containing 9
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R3738 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70244533-70347614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70251195 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 579 (T579A)
Ref Sequence ENSEMBL: ENSMUSP00000106149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110520] [ENSMUST00000110522] [ENSMUST00000222316] [ENSMUST00000223160]
Predicted Effect probably damaging
Transcript: ENSMUST00000110520
AA Change: T579A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106149
Gene: ENSMUSG00000021071
AA Change: T579A

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
Pfam:SPRY 598 702 2.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110522
AA Change: T653A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106151
Gene: ENSMUSG00000021071
AA Change: T653A

DomainStartEndE-ValueType
RING 10 131 1.23e-4 SMART
BBOX 163 212 2.84e-9 SMART
BBOX 224 266 9.89e-9 SMART
BBC 273 399 1.29e-38 SMART
FN3 439 522 4.09e-7 SMART
low complexity region 591 605 N/A INTRINSIC
Pfam:SPRY 674 776 1.5e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221294
AA Change: T625A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222173
Predicted Effect probably damaging
Transcript: ENSMUST00000222316
AA Change: T653A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223160
AA Change: T557A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223518
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display increased axonal branching and increased corpus callosum thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Abcb8 A G 5: 24,400,621 S168G probably benign Het
Ankrd11 A G 8: 122,896,715 probably benign Het
Api5 C T 2: 94,425,613 R243Q possibly damaging Het
Atp8b1 A G 18: 64,533,729 probably benign Het
Camk2d A G 3: 126,771,839 D136G probably damaging Het
Capn3 G A 2: 120,485,287 D227N possibly damaging Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Dlgap3 A G 4: 127,195,606 T332A probably damaging Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Fbxw18 T A 9: 109,688,913 Y335F possibly damaging Het
Gbp10 T A 5: 105,224,458 E145D possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Ifi203 T A 1: 173,929,474 probably benign Het
Insig1 T A 5: 28,071,703 I89N probably damaging Het
Itpkc T A 7: 27,227,604 D295V possibly damaging Het
Jak1 T C 4: 101,191,468 probably benign Het
Kctd9 G A 14: 67,734,288 D157N possibly damaging Het
Kmt2c A C 5: 25,405,383 F242V probably benign Het
Lcorl A T 5: 45,734,041 N323K possibly damaging Het
Lin54 T C 5: 100,459,806 probably benign Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mfsd2b A G 12: 4,870,578 S80P probably damaging Het
Myh9 G A 15: 77,766,812 R1612C probably damaging Het
Nr1d2 T A 14: 18,211,804 N433I possibly damaging Het
Olfr1217 T C 2: 89,023,610 Y131C probably damaging Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Olfr724 T C 14: 49,960,556 N172S possibly damaging Het
Pld4 T C 12: 112,768,035 I410T probably benign Het
Pnmal2 C T 7: 16,946,596 H502Y probably benign Het
Pramef8 T C 4: 143,416,642 probably benign Het
Rbbp8nl G T 2: 180,281,248 T184K probably benign Het
Saa4 T A 7: 46,729,629 N96Y possibly damaging Het
Serpinb6d T A 13: 33,667,680 V140E probably damaging Het
Ska3 A T 14: 57,811,596 M306K probably benign Het
Slfn4 T C 11: 83,185,311 M1T probably null Het
Sorcs1 T C 19: 50,151,221 I1168V probably benign Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Trpc2 G A 7: 102,084,504 S220N probably damaging Het
Ube2j1 A T 4: 33,036,723 M16L probably benign Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn2r62 G A 7: 42,787,887 P391L probably benign Het
Zfa-ps T A 10: 52,544,540 noncoding transcript Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Trim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Trim9 APN 12 70347113 missense probably damaging 0.98
IGL01618:Trim9 APN 12 70248351 missense probably benign
IGL01794:Trim9 APN 12 70281880 missense probably damaging 1.00
IGL03101:Trim9 APN 12 70346654 missense probably damaging 1.00
IGL03184:Trim9 APN 12 70251221 missense probably damaging 0.99
E0354:Trim9 UTSW 12 70272459 missense probably benign 0.01
IGL03098:Trim9 UTSW 12 70280693 missense possibly damaging 0.95
R0518:Trim9 UTSW 12 70346585 missense probably damaging 0.99
R0622:Trim9 UTSW 12 70346604 missense probably damaging 1.00
R0941:Trim9 UTSW 12 70248263 missense probably damaging 0.97
R1022:Trim9 UTSW 12 70252017 splice site probably null
R1024:Trim9 UTSW 12 70252017 splice site probably null
R1204:Trim9 UTSW 12 70346727 missense probably damaging 1.00
R1439:Trim9 UTSW 12 70251093 missense probably damaging 1.00
R1530:Trim9 UTSW 12 70272428 missense probably damaging 0.98
R1613:Trim9 UTSW 12 70248395 missense probably damaging 1.00
R1661:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1665:Trim9 UTSW 12 70255113 missense probably damaging 0.99
R1722:Trim9 UTSW 12 70248374 missense probably benign 0.33
R2097:Trim9 UTSW 12 70347159 missense probably damaging 1.00
R3082:Trim9 UTSW 12 70255113 missense possibly damaging 0.93
R3123:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3124:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R3125:Trim9 UTSW 12 70248393 missense probably damaging 1.00
R4013:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4017:Trim9 UTSW 12 70346352 missense probably damaging 1.00
R4560:Trim9 UTSW 12 70347118 nonsense probably null
R4734:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4748:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4749:Trim9 UTSW 12 70248273 missense probably damaging 1.00
R4777:Trim9 UTSW 12 70347071 missense probably damaging 1.00
R5027:Trim9 UTSW 12 70346708 missense probably damaging 0.96
R5451:Trim9 UTSW 12 70346829 missense probably benign 0.17
R5471:Trim9 UTSW 12 70346792 missense possibly damaging 0.93
R6394:Trim9 UTSW 12 70255213 missense possibly damaging 0.91
R6901:Trim9 UTSW 12 70346639 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGCTCCGGTTATTGTCCAC -3'
(R):5'- GACTCTGGCCCCAAATACTTC -3'

Sequencing Primer
(F):5'- ACATACATTGCCCAAGCTTTG -3'
(R):5'- AAATACTTCCTTCCTGCATGGC -3'
Posted On2015-03-18