Incidental Mutation 'R3814:Map3k5'
ID274199
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
MMRRC Submission 040769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3814 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20140680 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1339 (V1339D)
Ref Sequence ENSEMBL: ENSMUSP00000112864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259]
Predicted Effect probably damaging
Transcript: ENSMUST00000095806
AA Change: V1347D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: V1347D

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120259
AA Change: V1339D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: V1339D

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142726
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,992,919 V4A probably damaging Het
Abca4 C T 3: 122,170,921 probably benign Het
Adam20 G T 8: 40,795,675 W274L probably damaging Het
Cep78 T C 19: 15,981,802 probably null Het
Clhc1 T C 11: 29,571,826 I453T possibly damaging Het
Cyp2c55 T A 19: 39,007,065 L7Q probably damaging Het
Dnah2 A G 11: 69,492,650 probably null Het
Dpy19l3 G A 7: 35,727,292 Q64* probably null Het
Enthd1 T A 15: 80,452,682 Y517F probably benign Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
G2e3 C T 12: 51,353,661 T32I probably benign Het
Glb1l2 A G 9: 26,771,034 S302P probably benign Het
Ino80d C T 1: 63,074,424 R289Q probably benign Het
Itsn1 T C 16: 91,852,921 L161P possibly damaging Het
Kif19a A G 11: 114,781,919 Y256C probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Mib1 G A 18: 10,763,281 V444M probably benign Het
Mon2 T C 10: 123,013,565 I1277V probably damaging Het
Mvp T A 7: 126,987,629 M777L probably benign Het
Pik3c2a G A 7: 116,348,179 R1423W probably damaging Het
Prdm16 T C 4: 154,328,293 E1085G probably damaging Het
Prune1 A C 3: 95,265,439 V105G probably damaging Het
Rbpj G T 5: 53,653,172 E399* probably null Het
Rp1 C A 1: 4,349,708 V394L probably benign Het
S100a4 G A 3: 90,605,845 A83T probably benign Het
Satb1 T C 17: 51,782,907 H304R probably damaging Het
Slc6a17 T C 3: 107,471,317 E680G possibly damaging Het
Tbc1d4 A T 14: 101,458,755 I919N possibly damaging Het
Vmn2r102 A T 17: 19,678,831 K478N probably damaging Het
Zfp619 A C 7: 39,535,399 R284S probably benign Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
PIT4434001:Map3k5 UTSW 10 20026257 missense probably damaging 0.98
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1103:Map3k5 UTSW 10 20023676 missense probably benign 0.00
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1832:Map3k5 UTSW 10 20099560 missense probably damaging 1.00
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2214:Map3k5 UTSW 10 20026289 critical splice donor site probably null
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R2513:Map3k5 UTSW 10 20094455 missense possibly damaging 0.92
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5566:Map3k5 UTSW 10 20110719 missense probably damaging 1.00
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
R7304:Map3k5 UTSW 10 20099555 missense probably damaging 1.00
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACTCAACGTGTGTCTGTCTAATTC -3'
(R):5'- AGACACAGCCCTTCCTGATC -3'

Sequencing Primer
(F):5'- AGTCAGAAGGCTTTTCCTCTG -3'
(R):5'- TCCTGCAGAGCTGGTTAGAGAC -3'
Posted On2015-04-02