Incidental Mutation 'R1832:Map3k5'
ID204877
Institutional Source Beutler Lab
Gene Symbol Map3k5
Ensembl Gene ENSMUSG00000071369
Gene Namemitogen-activated protein kinase kinase kinase 5
SynonymsASK, ASK1, 7420452D20Rik, Mekk5
MMRRC Submission 039859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19934472-20142753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20099560 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 88 (N88D)
Ref Sequence ENSEMBL: ENSMUSP00000114518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095806] [ENSMUST00000120259] [ENSMUST00000129437]
Predicted Effect probably damaging
Transcript: ENSMUST00000095806
AA Change: N743D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093485
Gene: ENSMUSG00000071369
AA Change: N743D

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 552 2.1e-162 PFAM
S_TKc 687 945 8.08e-92 SMART
low complexity region 1195 1207 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
coiled coil region 1251 1292 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120259
AA Change: N735D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112864
Gene: ENSMUSG00000071369
AA Change: N735D

DomainStartEndE-ValueType
low complexity region 26 43 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
Pfam:DUF4071 172 544 1.7e-156 PFAM
S_TKc 679 937 8.08e-92 SMART
low complexity region 1187 1199 N/A INTRINSIC
low complexity region 1217 1230 N/A INTRINSIC
coiled coil region 1243 1284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129437
AA Change: N88D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114518
Gene: ENSMUSG00000071369
AA Change: N88D

DomainStartEndE-ValueType
Pfam:Pkinase 34 144 7.6e-20 PFAM
Pfam:Pkinase_Tyr 34 144 5e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000138994
AA Change: N12D
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase (MAPK) signaling cascades include MAPK or extracellular signal-regulated kinase (ERK), MAPK kinase (MKK or MEK), and MAPK kinase kinase (MAPKKK or MEKK). MAPKK kinase/MEKK phosphorylates and activates its downstream protein kinase, MAPK kinase/MEK, which in turn activates MAPK. The kinases of these signaling cascades are highly conserved, and homologs exist in yeast, Drosophila, and mammalian cells. MAPKKK5 contains 1,374 amino acids with all 11 kinase subdomains. Northern blot analysis shows that MAPKKK5 transcript is abundantly expressed in human heart and pancreas. The MAPKKK5 protein phosphorylates and activates MKK4 (aliases SERK1, MAPKK4) in vitro, and activates c-Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) during transient expression in COS and 293 cells; MAPKKK5 does not activate MAPK/ERK. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are overtly normal, however apoptosis abnormalities are evident in cultured cells and after induced heart damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Galc A G 12: 98,234,240 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Mixl1 A G 1: 180,694,731 V195A probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Plxna4 A C 6: 32,197,826 D1109E probably benign Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 probably benign Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sbno2 G T 10: 80,060,605 Y889* probably null Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc25a12 A G 2: 71,333,710 Y74H possibly damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Map3k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Map3k5 APN 10 19935044 missense possibly damaging 0.73
IGL00978:Map3k5 APN 10 20141567 missense probably damaging 1.00
IGL01470:Map3k5 APN 10 20118187 missense possibly damaging 0.89
IGL01992:Map3k5 APN 10 20029133 nonsense probably null
IGL02479:Map3k5 APN 10 20056484 missense probably damaging 1.00
IGL02728:Map3k5 APN 10 20118292 missense possibly damaging 0.71
IGL02812:Map3k5 APN 10 20025036 missense probably damaging 1.00
IGL03104:Map3k5 APN 10 20132055 missense probably benign
P0033:Map3k5 UTSW 10 20132213 splice site probably benign
R0284:Map3k5 UTSW 10 20000613 missense probably damaging 0.99
R1103:Map3k5 UTSW 10 20023676 missense probably benign 0.00
R1172:Map3k5 UTSW 10 20056648 intron probably benign
R1250:Map3k5 UTSW 10 20110775 missense possibly damaging 0.73
R1493:Map3k5 UTSW 10 20029113 missense probably damaging 1.00
R1634:Map3k5 UTSW 10 20136911 missense possibly damaging 0.64
R1693:Map3k5 UTSW 10 20104242 missense probably damaging 1.00
R1713:Map3k5 UTSW 10 20110847 missense possibly damaging 0.79
R1844:Map3k5 UTSW 10 20104163 missense probably benign 0.33
R1869:Map3k5 UTSW 10 20132109 nonsense probably null
R2156:Map3k5 UTSW 10 20024937 missense probably damaging 1.00
R2214:Map3k5 UTSW 10 20026289 critical splice donor site probably null
R2221:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2223:Map3k5 UTSW 10 20067920 missense possibly damaging 0.96
R2249:Map3k5 UTSW 10 20127697 missense probably damaging 0.99
R2418:Map3k5 UTSW 10 20110857 missense probably benign 0.02
R2513:Map3k5 UTSW 10 20094455 missense possibly damaging 0.92
R3014:Map3k5 UTSW 10 20094429 missense probably damaging 1.00
R3770:Map3k5 UTSW 10 20025019 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20026190 missense probably damaging 0.99
R3814:Map3k5 UTSW 10 20140680 missense probably damaging 0.99
R4706:Map3k5 UTSW 10 20058938 missense probably damaging 1.00
R4749:Map3k5 UTSW 10 20132052 missense probably benign 0.42
R4903:Map3k5 UTSW 10 20118489 missense probably null 1.00
R4958:Map3k5 UTSW 10 20023789 missense possibly damaging 0.79
R5065:Map3k5 UTSW 10 20082467 missense probably damaging 1.00
R5210:Map3k5 UTSW 10 20024901 missense possibly damaging 0.82
R5245:Map3k5 UTSW 10 20140691 missense probably benign 0.00
R5304:Map3k5 UTSW 10 20108238 missense probably benign 0.13
R5428:Map3k5 UTSW 10 20023653 missense possibly damaging 0.93
R5566:Map3k5 UTSW 10 20110719 missense probably damaging 1.00
R5914:Map3k5 UTSW 10 20104255 missense probably benign 0.24
R6155:Map3k5 UTSW 10 20118441 missense probably benign 0.01
R6161:Map3k5 UTSW 10 20000575 missense probably damaging 0.98
R6191:Map3k5 UTSW 10 20023669 missense probably damaging 0.99
R6251:Map3k5 UTSW 10 20138260 splice site probably null
R6800:Map3k5 UTSW 10 20141580 makesense probably null
X0017:Map3k5 UTSW 10 20118434 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATAAAGGCCTTGGACGGTCATTG -3'
(R):5'- GAGTAGCGTCAAGTTCATGTCAC -3'

Sequencing Primer
(F):5'- CATTGGTTTTATTTGTGGGCACAG -3'
(R):5'- AAGTTCATGTCACCCATCTGAC -3'
Posted On2014-06-23