Incidental Mutation 'R3945:Sin3b'
ID307655
Institutional Source Beutler Lab
Gene Symbol Sin3b
Ensembl Gene ENSMUSG00000031622
Gene Nametranscriptional regulator, SIN3B (yeast)
Synonyms2810430C10Rik
MMRRC Submission 040926-MU
Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3945 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72723285-72758201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72733439 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 218 (D218G)
Ref Sequence ENSEMBL: ENSMUSP00000148407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004494] [ENSMUST00000109950] [ENSMUST00000212095] [ENSMUST00000212096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004494
AA Change: D218G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622
AA Change: D218G

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 2.5e-19 PFAM
Pfam:PAH 173 227 4.4e-20 PFAM
Pfam:PAH 313 357 1.6e-8 PFAM
HDAC_interact 384 484 2.75e-58 SMART
low complexity region 667 688 N/A INTRINSIC
Pfam:Sin3a_C 712 1011 7.2e-81 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109950
AA Change: D218G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105576
Gene: ENSMUSG00000031622
AA Change: D218G

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 3.4e-20 PFAM
Pfam:PAH 173 227 5.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212095
AA Change: D218G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212096
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Actn4 T C 7: 28,912,236 probably null Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Sin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Sin3b APN 8 72757000 missense probably benign 0.22
IGL01107:Sin3b APN 8 72731105 missense possibly damaging 0.74
IGL01114:Sin3b APN 8 72744505 missense probably benign 0.06
IGL01603:Sin3b APN 8 72750064 missense probably damaging 1.00
IGL01763:Sin3b APN 8 72746608 missense probably damaging 1.00
IGL02078:Sin3b APN 8 72753580 missense possibly damaging 0.49
IGL02572:Sin3b APN 8 72744481 missense probably benign 0.15
IGL02732:Sin3b APN 8 72733453 missense possibly damaging 0.72
IGL02831:Sin3b APN 8 72744562 missense probably damaging 1.00
IGL03064:Sin3b APN 8 72757058 unclassified probably benign
IGL03107:Sin3b APN 8 72753585 missense probably damaging 0.99
IGL03142:Sin3b APN 8 72744568 missense probably damaging 1.00
3-1:Sin3b UTSW 8 72753209 missense possibly damaging 0.95
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0226:Sin3b UTSW 8 72744508 missense probably benign 0.44
R0629:Sin3b UTSW 8 72753536 splice site probably benign
R1486:Sin3b UTSW 8 72750513 missense probably benign 0.00
R1524:Sin3b UTSW 8 72753287 missense probably benign 0.05
R1653:Sin3b UTSW 8 72741519 missense probably benign 0.30
R2144:Sin3b UTSW 8 72731265 missense probably damaging 1.00
R2180:Sin3b UTSW 8 72753295 nonsense probably null
R2271:Sin3b UTSW 8 72733419 missense probably benign 0.11
R2353:Sin3b UTSW 8 72724152 critical splice donor site probably null
R4412:Sin3b UTSW 8 72739779 missense probably benign 0.16
R4564:Sin3b UTSW 8 72753581 missense probably damaging 1.00
R4782:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4799:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4863:Sin3b UTSW 8 72744948 missense possibly damaging 0.91
R5011:Sin3b UTSW 8 72744556 missense probably benign 0.39
R5237:Sin3b UTSW 8 72733343 critical splice acceptor site probably null
R5325:Sin3b UTSW 8 72750526 missense probably damaging 1.00
R5725:Sin3b UTSW 8 72725692 critical splice donor site probably null
R5927:Sin3b UTSW 8 72749878 missense probably benign 0.00
R5945:Sin3b UTSW 8 72731165 missense probably damaging 0.97
R6492:Sin3b UTSW 8 72733490 critical splice donor site probably null
X0017:Sin3b UTSW 8 72731165 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAAGGCTGATGTCTGCACAAC -3'
(R):5'- GTCCCAGGCACCTATACAAG -3'

Sequencing Primer
(F):5'- GATGTCTGCACAACTGCCC -3'
(R):5'- CTGGAGCACTGTCCTCAAATTGG -3'
Posted On2015-04-17