Incidental Mutation 'R3945:Actn4'
ID307645
Institutional Source Beutler Lab
Gene Symbol Actn4
Ensembl Gene ENSMUSG00000054808
Gene Nameactinin alpha 4
Synonyms
MMRRC Submission 040926-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R3945 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28893248-28962340 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 28912236 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068045] [ENSMUST00000127210] [ENSMUST00000127210] [ENSMUST00000140622] [ENSMUST00000140622] [ENSMUST00000148196] [ENSMUST00000217157]
Predicted Effect probably null
Transcript: ENSMUST00000068045
SMART Domains Protein: ENSMUSP00000066068
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 3.49e-24 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
SPEC 532 639 8.64e-9 SMART
SPEC 653 752 3.56e0 SMART
EFh 770 798 1.92e-3 SMART
EFh 811 839 1.56e-3 SMART
efhand_Ca_insen 842 908 1.27e-36 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127210
SMART Domains Protein: ENSMUSP00000115436
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
CH 53 153 1.08e-24 SMART
CH 166 265 1.03e-21 SMART
SPEC 297 403 2.83e0 SMART
SPEC 417 518 3.78e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140622
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140622
SMART Domains Protein: ENSMUSP00000123210
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
CH 81 180 3.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144909
Predicted Effect probably benign
Transcript: ENSMUST00000148196
SMART Domains Protein: ENSMUSP00000122268
Gene: ENSMUSG00000054808

DomainStartEndE-ValueType
CH 3 68 1.09e-1 SMART
Pfam:CH 82 133 4.5e-11 PFAM
Pfam:CAMSAP_CH 89 133 9.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150493
Predicted Effect probably null
Transcript: ENSMUST00000217157
Meta Mutation Damage Score 0.61 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die either around birth or within a few months of birth. Those who do survive after birth show poor growth and kidney abnormalities including glomerulosclerosis. This is manifested functionally as proteinuria and abnormal blood urea nitrogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,289,964 I2229T probably damaging Het
4930407I10Rik T C 15: 82,065,400 L1166P probably damaging Het
Adamts17 A T 7: 67,120,939 E905V probably benign Het
Adck5 A G 15: 76,595,200 N485S probably damaging Het
Agr3 C A 12: 35,947,513 probably benign Het
Ankrd12 G A 17: 65,976,103 T1921I probably damaging Het
Ascl2 T C 7: 142,967,971 S247G probably benign Het
Atp7b T C 8: 22,020,864 E422G probably benign Het
C630050I24Rik C T 8: 107,119,262 R15* probably null Het
Cabin1 T G 10: 75,745,259 Q411P probably damaging Het
Chrne T C 11: 70,617,043 I277V possibly damaging Het
Coch A G 12: 51,601,812 probably null Het
Corin A G 5: 72,358,424 V429A probably damaging Het
Cpa3 A T 3: 20,225,117 N219K probably damaging Het
Creb3l1 T C 2: 91,991,211 E273G probably damaging Het
Csmd1 A C 8: 15,910,619 probably null Het
Ddx59 A G 1: 136,434,618 D527G probably damaging Het
Defa25 G A 8: 21,084,490 V17I probably null Het
Efs A G 14: 54,920,651 probably benign Het
Ern2 A G 7: 122,176,530 M447T probably benign Het
Fgfr2 C T 7: 130,177,755 E596K possibly damaging Het
Filip1 T C 9: 79,818,367 K990R probably benign Het
Ipo8 T A 6: 148,818,117 Q110L probably damaging Het
Kank4 T A 4: 98,771,280 I854F probably damaging Het
Mst1 G A 9: 108,084,853 C681Y probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr1289 C T 2: 111,483,687 Q86* probably null Het
Olfr1496 A G 19: 13,781,422 E270G probably benign Het
Pde11a T C 2: 76,075,931 probably benign Het
Ptprq A G 10: 107,686,392 probably benign Het
Rcbtb1 G A 14: 59,224,776 probably null Het
Rpl37 G A 15: 5,117,694 R72H probably benign Het
Samd9l A T 6: 3,377,029 S77R possibly damaging Het
Sin3b A G 8: 72,733,439 D218G possibly damaging Het
Slc22a23 A G 13: 34,183,126 I633T probably damaging Het
Spen T C 4: 141,477,353 D1321G unknown Het
Ssh2 T C 11: 77,454,668 S1160P possibly damaging Het
Synrg T A 11: 84,023,406 D952E probably damaging Het
Tigd3 A G 19: 5,892,433 F223S probably damaging Het
Trim66 G A 7: 109,472,268 T608I possibly damaging Het
Trmt13 A G 3: 116,581,518 F447S probably damaging Het
Trpc2 T C 7: 102,088,279 I800T possibly damaging Het
Ugt3a2 A T 15: 9,370,098 I443F possibly damaging Het
Vamp2 C A 11: 69,089,174 P24Q unknown Het
Vmn1r113 A G 7: 20,787,712 Y143C probably benign Het
Vmn1r14 T A 6: 57,234,269 N277K probably benign Het
Vmn1r181 T A 7: 23,984,152 V14E probably damaging Het
Wdfy4 A T 14: 32,966,395 I3086N probably damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Actn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Actn4 APN 7 28904684 missense probably damaging 1.00
IGL02127:Actn4 APN 7 28897880 missense probably benign
IGL02192:Actn4 APN 7 28898400 missense possibly damaging 0.93
IGL02862:Actn4 APN 7 28912234 splice site probably benign
IGL03339:Actn4 APN 7 28901982 missense probably damaging 1.00
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0067:Actn4 UTSW 7 28911570 missense possibly damaging 0.67
R0243:Actn4 UTSW 7 28905398 missense probably benign 0.29
R0689:Actn4 UTSW 7 28897049 missense probably damaging 1.00
R0845:Actn4 UTSW 7 28913430 missense probably damaging 1.00
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1469:Actn4 UTSW 7 28898266 splice site probably benign
R1469:Actn4 UTSW 7 28905328 missense probably benign 0.15
R1581:Actn4 UTSW 7 28898646 missense probably benign 0.04
R1690:Actn4 UTSW 7 28911525 missense probably damaging 1.00
R1962:Actn4 UTSW 7 28894622 missense probably damaging 1.00
R2113:Actn4 UTSW 7 28898124 missense probably benign 0.42
R2215:Actn4 UTSW 7 28918753 missense possibly damaging 0.88
R2429:Actn4 UTSW 7 28898071 missense probably benign 0.00
R3962:Actn4 UTSW 7 28898222 unclassified probably null
R3970:Actn4 UTSW 7 28962032 missense probably benign
R4909:Actn4 UTSW 7 28898657 missense probably damaging 1.00
R4985:Actn4 UTSW 7 28918986 missense probably damaging 1.00
R5155:Actn4 UTSW 7 28962017 critical splice donor site probably null
R5201:Actn4 UTSW 7 28916255 splice site probably null
R5668:Actn4 UTSW 7 28904550 missense probably damaging 1.00
R5818:Actn4 UTSW 7 28919019 missense probably damaging 1.00
R6046:Actn4 UTSW 7 28904619 missense probably benign 0.03
R6155:Actn4 UTSW 7 28896141 missense probably damaging 1.00
R6559:Actn4 UTSW 7 28907036 missense possibly damaging 0.87
R7224:Actn4 UTSW 7 28962084 missense probably benign 0.08
R7225:Actn4 UTSW 7 28898699 missense probably damaging 1.00
R7423:Actn4 UTSW 7 28894255 missense probably damaging 0.97
Z1088:Actn4 UTSW 7 28894578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTCTGACTGCATCTGGCC -3'
(R):5'- AGCACACCGGGATGAGAATTC -3'

Sequencing Primer
(F):5'- GACTGCATCTGGCCATACC -3'
(R):5'- CCGGGATGAGAATTCCTGATACTC -3'
Posted On2015-04-17