Incidental Mutation 'R3976:Prdm6'
ID312667
Institutional Source Beutler Lab
Gene Symbol Prdm6
Ensembl Gene ENSMUSG00000069378
Gene NamePR domain containing 6
SynonymsLOC225518, PRISM
MMRRC Submission 040842-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R3976 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location53464546-53575907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53540206 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 186 (I186T)
Ref Sequence ENSEMBL: ENSMUSP00000114644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091900] [ENSMUST00000115399] [ENSMUST00000154557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091900
AA Change: I347T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089513
Gene: ENSMUSG00000069378
AA Change: I347T

DomainStartEndE-ValueType
low complexity region 26 73 N/A INTRINSIC
low complexity region 77 113 N/A INTRINSIC
low complexity region 118 135 N/A INTRINSIC
low complexity region 141 166 N/A INTRINSIC
low complexity region 229 236 N/A INTRINSIC
SET 249 372 1.98e-3 SMART
ZnF_C2H2 474 494 1.24e2 SMART
ZnF_C2H2 502 524 1.58e-3 SMART
ZnF_C2H2 530 552 1.47e-3 SMART
ZnF_C2H2 558 578 1.2e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115399
AA Change: I146T

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111057
Gene: ENSMUSG00000069378
AA Change: I146T

DomainStartEndE-ValueType
low complexity region 28 35 N/A INTRINSIC
SET 48 171 1.98e-3 SMART
ZnF_C2H2 273 293 1.24e2 SMART
ZnF_C2H2 301 323 1.58e-3 SMART
ZnF_C2H2 329 351 1.47e-3 SMART
ZnF_C2H2 357 377 1.2e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154557
AA Change: I186T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114644
Gene: ENSMUSG00000069378
AA Change: I186T

DomainStartEndE-ValueType
low complexity region 68 75 N/A INTRINSIC
SET 88 211 1.98e-3 SMART
ZnF_C2H2 313 333 1.24e2 SMART
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 417 1.2e1 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiovascular development defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,431 S466T probably benign Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Asb4 A T 6: 5,390,771 M55L probably benign Het
Atxn7l1 T C 12: 33,325,955 S10P probably damaging Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Cyb5r3 A G 15: 83,160,129 V180A possibly damaging Het
Dglucy A T 12: 100,841,389 T186S probably benign Het
Eml5 A T 12: 98,802,465 probably benign Het
Fam90a1a G A 8: 21,961,416 D98N probably damaging Het
Fbxo16 T A 14: 65,287,157 L42Q probably damaging Het
Fbxw16 A G 9: 109,439,629 V231A probably benign Het
Fermt3 G A 19: 7,002,424 A447V possibly damaging Het
Fignl2 A G 15: 101,052,586 L605P unknown Het
Gcsam T G 16: 45,619,829 N78K probably damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm28042 C T 2: 120,036,756 H218Y probably benign Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Herpud2 A G 9: 25,110,438 V304A probably damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrp3 T C 7: 35,204,105 D251G probably benign Het
Mapkbp1 T C 2: 120,021,858 V957A possibly damaging Het
Mepe C T 5: 104,337,078 P28L probably benign Het
Muc2 T A 7: 141,746,804 probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1306 C T 2: 111,912,606 G108D possibly damaging Het
Olfr267 A G 4: 58,785,164 L186P probably damaging Het
Opn4 C T 14: 34,597,109 R173H probably benign Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Rab18 T A 18: 6,778,529 D53E probably benign Het
Rel A G 11: 23,742,939 S365P probably benign Het
Rhbg C A 3: 88,244,536 G383V probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Runx2 T C 17: 44,610,079 T339A possibly damaging Het
Ryr3 T C 2: 112,675,837 E3455G possibly damaging Het
Serpina1d A T 12: 103,767,848 S66T probably benign Het
Setd3 T C 12: 108,165,158 K3R possibly damaging Het
Spg7 A G 8: 123,079,448 D299G probably damaging Het
Sptbn5 C T 2: 120,048,261 noncoding transcript Het
Srcap A G 7: 127,549,239 T1859A probably benign Het
Suox A G 10: 128,671,037 V374A probably damaging Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tubal3 C T 13: 3,932,946 S242L probably benign Het
Ugt2b1 C A 5: 86,917,675 V502L probably benign Het
Other mutations in Prdm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Prdm6 APN 18 53540285 missense probably benign 0.08
IGL00743:Prdm6 APN 18 53540228 missense possibly damaging 0.84
IGL02183:Prdm6 APN 18 53464677 unclassified probably benign
R1720:Prdm6 UTSW 18 53540200 missense probably benign 0.29
R1879:Prdm6 UTSW 18 53568217 missense probably damaging 1.00
R1950:Prdm6 UTSW 18 53536724 missense possibly damaging 0.90
R1962:Prdm6 UTSW 18 53568161 missense probably damaging 1.00
R2022:Prdm6 UTSW 18 53464959 unclassified probably benign
R3973:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3974:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R3975:Prdm6 UTSW 18 53540206 missense possibly damaging 0.94
R4012:Prdm6 UTSW 18 53540318 missense possibly damaging 0.70
R5144:Prdm6 UTSW 18 53465038 unclassified probably benign
R5640:Prdm6 UTSW 18 53536741 critical splice donor site probably null
R6113:Prdm6 UTSW 18 53473601 missense probably damaging 1.00
R6701:Prdm6 UTSW 18 53536679 missense possibly damaging 0.93
R6747:Prdm6 UTSW 18 53465046 unclassified probably benign
R6784:Prdm6 UTSW 18 53536626 missense probably benign 0.04
R7363:Prdm6 UTSW 18 53465127 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GGACATTGTTTACCATGCCGAG -3'
(R):5'- GACCCATGCATGTCTATCATTAGC -3'

Sequencing Primer
(F):5'- CATTGTTTACCATGCCGAGTTAGAG -3'
(R):5'- CCATGCATGTCTATCATTAGCAAATC -3'
Posted On2015-04-30