Incidental Mutation 'R4024:Hnmt'
ID313373
Institutional Source Beutler Lab
Gene Symbol Hnmt
Ensembl Gene ENSMUSG00000026986
Gene Namehistamine N-methyltransferase
Synonyms1500031F01Rik
MMRRC Submission 041612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4024 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24002910-24049394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24003765 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 239 (D239G)
Ref Sequence ENSEMBL: ENSMUSP00000110142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051416] [ENSMUST00000114497] [ENSMUST00000114498]
Predicted Effect probably benign
Transcript: ENSMUST00000051416
AA Change: D239G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062747
Gene: ENSMUSG00000026986
AA Change: D239G

DomainStartEndE-ValueType
Pfam:Methyltransf_23 30 218 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114497
AA Change: D239G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110141
Gene: ENSMUSG00000026986
AA Change: D239G

DomainStartEndE-ValueType
Pfam:Methyltransf_23 29 218 4.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114498
AA Change: D239G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110142
Gene: ENSMUSG00000026986
AA Change: D239G

DomainStartEndE-ValueType
Pfam:Methyltransf_23 30 218 3.6e-16 PFAM
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit elevated histamine levels in the brain, increased aggression, hypoactivity and altered sleep-wake cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn1 A G 12: 80,168,477 Y842H probably damaging Het
Adamts9 A G 6: 92,872,784 probably benign Het
Adgrg7 A T 16: 56,730,298 Y684N probably damaging Het
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Armc2 A G 10: 41,993,058 S37P probably benign Het
Bhmt2 G A 13: 93,663,331 probably benign Het
Bpifb1 A T 2: 154,213,046 D286V probably damaging Het
Cadps T A 14: 12,705,539 E285D probably damaging Het
Cap2 C T 13: 46,637,841 probably benign Het
Clcn4 T G 7: 7,290,428 Y443S probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Cmip A G 8: 117,447,416 I412V possibly damaging Het
Cndp1 T C 18: 84,628,813 D250G probably damaging Het
Colec10 A G 15: 54,462,551 D259G probably damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Dlec1 T C 9: 119,137,340 Y1126H probably damaging Het
Dzank1 T C 2: 144,482,227 S565G probably benign Het
Eef2k A G 7: 120,858,598 Y60C probably benign Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl4 T C 4: 22,377,074 V170A possibly damaging Het
Foxk2 T A 11: 121,285,613 I195N possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gpr6 G A 10: 41,071,268 T106M probably damaging Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Igf2 A G 7: 142,654,307 V111A probably benign Het
Lrriq3 G A 3: 155,188,302 E547K probably benign Het
Lrriq4 T C 3: 30,650,273 V150A possibly damaging Het
Mroh8 A G 2: 157,256,352 V292A probably benign Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nisch A G 14: 31,176,819 probably benign Het
Nkx2-2 T C 2: 147,184,234 T195A probably benign Het
Olfr1132 T A 2: 87,635,155 L197F probably damaging Het
Olfr328 G A 11: 58,551,396 T281I possibly damaging Het
Olfr432 C T 1: 174,051,117 T248I probably benign Het
Olfr487 A T 7: 108,211,742 Y262* probably null Het
Plekhn1 A G 4: 156,224,750 V233A probably damaging Het
Ppp3r1 T C 11: 17,194,786 V133A probably damaging Het
Sash1 T C 10: 8,729,917 D903G probably benign Het
Scn8a A G 15: 101,039,793 D1681G probably damaging Het
Slk A G 19: 47,622,370 probably null Het
Tlr11 C T 14: 50,362,846 T763I probably benign Het
Ttbk2 T C 2: 120,760,255 T308A possibly damaging Het
Tyk2 G A 9: 21,115,919 L552F probably damaging Het
Ubp1 A G 9: 113,944,883 D50G probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ulk4 A T 9: 121,044,849 I1172N possibly damaging Het
Usf3 T A 16: 44,216,165 V336E possibly damaging Het
Vangl2 T C 1: 172,008,041 S355G probably benign Het
Vmn1r216 A G 13: 23,099,891 D248G probably damaging Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Vmn2r120 T A 17: 57,536,718 D42V possibly damaging Het
Vmn2r6 A T 3: 64,538,250 S685T possibly damaging Het
Vsig10l T C 7: 43,468,086 V701A probably benign Het
Wdfy3 A G 5: 101,924,095 probably benign Het
Zfp808 T A 13: 62,171,730 C258S possibly damaging Het
Zfp988 A C 4: 147,332,785 K559Q probably benign Het
Other mutations in Hnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Hnmt APN 2 24003884 nonsense probably null
IGL00857:Hnmt APN 2 24003783 missense probably benign 0.04
IGL01315:Hnmt APN 2 24019168 missense probably benign 0.02
IGL02205:Hnmt APN 2 24019145 missense probably damaging 1.00
IGL02647:Hnmt APN 2 24014307 missense possibly damaging 0.79
IGL03123:Hnmt APN 2 24019159 missense probably benign
IGL03137:Hnmt APN 2 24048739 missense probably damaging 0.99
R0018:Hnmt UTSW 2 24003628 missense possibly damaging 0.69
R1959:Hnmt UTSW 2 24003882 missense possibly damaging 0.84
R2106:Hnmt UTSW 2 24019118 missense probably benign 0.19
R2426:Hnmt UTSW 2 24019155 missense probably benign 0.11
R4590:Hnmt UTSW 2 24019099 splice site probably null
R5643:Hnmt UTSW 2 24014239 missense probably damaging 1.00
R5644:Hnmt UTSW 2 24014239 missense probably damaging 1.00
R6240:Hnmt UTSW 2 24014269 missense probably benign 0.00
R7153:Hnmt UTSW 2 24014341 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTAAGAAAGCCTAAGTTGTCTTGG -3'
(R):5'- CTAGTGGCTGGGAAAAGCTATG -3'

Sequencing Primer
(F):5'- ATGAGCTCTGGATACTCTTATGAC -3'
(R):5'- CTATGGAAAAAGTATGGATCCCGCC -3'
Posted On2015-04-30