Incidental Mutation 'R4034:Arap1'
ID313621
Institutional Source Beutler Lab
Gene Symbol Arap1
Ensembl Gene ENSMUSG00000032812
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
SynonymsCentd2, 2410002L19Rik
MMRRC Submission 040962-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4034 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101348067-101412586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101400277 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 982 (Y982F)
Ref Sequence ENSEMBL: ENSMUSP00000102624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084895] [ENSMUST00000084896] [ENSMUST00000098243] [ENSMUST00000107010] [ENSMUST00000155754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084895
AA Change: Y734F

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081957
Gene: ENSMUSG00000032812
AA Change: Y734F

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
PH 82 175 2.62e-17 SMART
PH 195 285 3.6e-6 SMART
ArfGap 289 415 2.4e-22 SMART
PH 498 606 1.23e-13 SMART
PH 616 710 1.08e0 SMART
RhoGAP 722 904 1.35e-63 SMART
Pfam:RA 926 1015 1.5e-10 PFAM
PH 1029 1141 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084896
AA Change: Y982F

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081958
Gene: ENSMUSG00000032812
AA Change: Y982F

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 6.6e-13 PFAM
PH 1277 1400 8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098243
AA Change: Y268F

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095844
Gene: ENSMUSG00000032812
AA Change: Y268F

DomainStartEndE-ValueType
PH 32 140 1.23e-13 SMART
PH 150 244 1.08e0 SMART
RhoGAP 256 438 1.35e-63 SMART
Pfam:RA 460 549 1.2e-11 PFAM
PH 563 675 8.58e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107010
AA Change: Y982F

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102624
Gene: ENSMUSG00000032812
AA Change: Y982F

DomainStartEndE-ValueType
SAM 3 70 1.72e-7 SMART
low complexity region 92 104 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 197 227 N/A INTRINSIC
low complexity region 267 285 N/A INTRINSIC
PH 330 423 2.62e-17 SMART
PH 443 533 3.6e-6 SMART
ArfGap 537 663 2.4e-22 SMART
PH 746 854 1.23e-13 SMART
PH 864 958 1.08e0 SMART
RhoGAP 970 1152 1.35e-63 SMART
Pfam:RA 1174 1263 1.9e-10 PFAM
PH 1277 1389 8.58e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153340
Predicted Effect probably benign
Transcript: ENSMUST00000155754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210162
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains SAM, ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology (PH) domains. In vitro, this protein displays RHO-GAP and phosphatidylinositol (3,4,5) trisphosphate (PIP3)-dependent ARF-GAP activity. The encoded protein associates with the Golgi, and the ARF-GAP activity mediates changes in the Golgi and the formation of filopodia. It is thought to regulate the cell-specific trafficking of a receptor protein involved in apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 A T 11: 49,019,281 L775* probably null Het
Aarsd1 C T 11: 101,411,332 V301I probably damaging Het
Aspa T C 11: 73,308,771 K227E possibly damaging Het
Ccdc88c G A 12: 100,930,524 A1389V possibly damaging Het
Cngb1 C A 8: 95,264,450 C708F possibly damaging Het
Csn1s2a A G 5: 87,781,887 Q115R probably benign Het
Cwf19l2 A T 9: 3,456,803 H712L probably benign Het
Eml6 C A 11: 29,803,137 V925L probably benign Het
Fbll1 G A 11: 35,797,678 H253Y possibly damaging Het
Gm8251 A G 1: 44,058,866 V1024A probably benign Het
Hmgcr C G 13: 96,651,063 L852F probably damaging Het
Ltbp2 A T 12: 84,804,474 C836S probably damaging Het
Mroh9 A G 1: 163,080,553 probably null Het
Muc5ac G A 7: 141,799,844 probably null Het
Olfr1385 A G 11: 49,495,460 D309G possibly damaging Het
Pgm5 T A 19: 24,861,657 I45F probably damaging Het
Ppl T C 16: 5,106,857 T115A probably benign Het
Sgpp1 A G 12: 75,716,190 Y406H probably damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
St18 G A 1: 6,855,473 probably null Het
Tcerg1 T A 18: 42,519,533 N75K unknown Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Usp42 C T 5: 143,715,439 S943N probably benign Het
Utp20 C T 10: 88,762,806 V103I probably benign Het
Vmn1r14 G A 6: 57,234,325 R252H possibly damaging Het
Wapl T C 14: 34,737,914 V1013A possibly damaging Het
Zfp37 G A 4: 62,191,696 T414I probably damaging Het
Zfp423 A G 8: 87,781,344 C666R probably damaging Het
Other mutations in Arap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Arap1 APN 7 101388049 missense probably damaging 0.96
IGL01311:Arap1 APN 7 101388136 nonsense probably null
IGL01349:Arap1 APN 7 101387152 missense possibly damaging 0.84
IGL01521:Arap1 APN 7 101400605 critical splice donor site probably null
IGL01869:Arap1 APN 7 101400283 missense probably damaging 1.00
IGL02156:Arap1 APN 7 101388730 unclassified probably benign
IGL02320:Arap1 APN 7 101385029 missense probably benign
IGL02478:Arap1 APN 7 101400125 splice site probably null
R0133:Arap1 UTSW 7 101386229 missense probably damaging 0.98
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0233:Arap1 UTSW 7 101400241 missense possibly damaging 0.47
R0412:Arap1 UTSW 7 101390222 missense probably damaging 0.98
R0616:Arap1 UTSW 7 101401650 missense possibly damaging 0.64
R0838:Arap1 UTSW 7 101400412 missense probably damaging 1.00
R0962:Arap1 UTSW 7 101384914 missense possibly damaging 0.56
R1186:Arap1 UTSW 7 101404269 splice site probably benign
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1405:Arap1 UTSW 7 101398436 splice site probably null
R1724:Arap1 UTSW 7 101400526 missense possibly damaging 0.91
R1793:Arap1 UTSW 7 101388622 missense probably benign
R1959:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R1960:Arap1 UTSW 7 101373015 missense probably damaging 1.00
R2020:Arap1 UTSW 7 101401518 missense probably benign 0.00
R2128:Arap1 UTSW 7 101409320 missense probably damaging 1.00
R3737:Arap1 UTSW 7 101400277 missense possibly damaging 0.85
R3851:Arap1 UTSW 7 101390165 nonsense probably null
R4386:Arap1 UTSW 7 101385571 missense probably benign
R4435:Arap1 UTSW 7 101390254 missense possibly damaging 0.74
R4779:Arap1 UTSW 7 101404367 missense probably damaging 1.00
R4786:Arap1 UTSW 7 101385005 missense possibly damaging 0.94
R4850:Arap1 UTSW 7 101398791 missense probably damaging 1.00
R4942:Arap1 UTSW 7 101401802 missense possibly damaging 0.95
R5253:Arap1 UTSW 7 101388644 missense probably benign 0.00
R5342:Arap1 UTSW 7 101404960 missense probably benign 0.00
R5367:Arap1 UTSW 7 101409130 missense probably damaging 0.99
R5397:Arap1 UTSW 7 101384912 missense possibly damaging 0.95
R5968:Arap1 UTSW 7 101394738 missense probably damaging 1.00
R6052:Arap1 UTSW 7 101404033 missense probably damaging 1.00
R6574:Arap1 UTSW 7 101404001 missense probably damaging 1.00
R6645:Arap1 UTSW 7 101408111 missense possibly damaging 0.57
R7060:Arap1 UTSW 7 101409357 splice site probably null
R7191:Arap1 UTSW 7 101384992 missense probably benign 0.31
R7323:Arap1 UTSW 7 101400211 missense probably damaging 1.00
R7349:Arap1 UTSW 7 101390228 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGGTGGGACAGTGACTATC -3'
(R):5'- TCCCTCCTTTAGGTGCACAGAG -3'

Sequencing Primer
(F):5'- GACAGTGACTATCTCTGCTCCAGG -3'
(R):5'- CTGTCTAGCAGTCTCTGAGTCTTG -3'
Posted On2015-04-30