Incidental Mutation 'R4160:Ptpn1'
ID 315689
Institutional Source Beutler Lab
Gene Symbol Ptpn1
Ensembl Gene ENSMUSG00000027540
Gene Name protein tyrosine phosphatase, non-receptor type 1
Synonyms PTP1B, PTP-1B
MMRRC Submission 041003-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.916) question?
Stock # R4160 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 167773977-167821305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 167809731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 113 (I113T)
Ref Sequence ENSEMBL: ENSMUSP00000029053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029053]
AlphaFold P35821
Predicted Effect probably benign
Transcript: ENSMUST00000029053
AA Change: I113T

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029053
Gene: ENSMUSG00000027540
AA Change: I113T

DomainStartEndE-ValueType
PTPc 15 279 1.35e-123 SMART
low complexity region 301 320 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 387 397 N/A INTRINSIC
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147210
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151705
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 89% (34/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the founding member of the protein tyrosine phosphatase (PTP) family, which was isolated and identified based on its enzymatic activity and amino acid sequence. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP has been shown to act as a negative regulator of insulin signaling by dephosphorylating the phosphotryosine residues of insulin receptor kinase. This PTP was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of this PTP in cell growth control, and cell response to interferon stimulation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit greatly reduced adiposity due to reduced fat cell mass, increased basal metabolic rate, mild hypoglycemia and hypoinsulinemia, increased insulin sensitivity, and enhanced sensitivity to leptin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf4 G T 17: 42,978,568 (GRCm39) H258Q probably benign Het
Ankrd1 T A 19: 36,095,273 (GRCm39) K138N probably damaging Het
Arhgef19 T C 4: 140,973,660 (GRCm39) I49T possibly damaging Het
Bltp3a A G 17: 28,103,061 (GRCm39) Y365C probably damaging Het
Cacnb3 G T 15: 98,538,601 (GRCm39) G148C probably damaging Het
Cep350 G A 1: 155,808,621 (GRCm39) R652W probably damaging Het
Cyp19a1 G A 9: 54,093,980 (GRCm39) T94I probably damaging Het
D130043K22Rik A C 13: 25,046,679 (GRCm39) E360D probably benign Het
Dse A G 10: 34,029,330 (GRCm39) F587L probably damaging Het
Efcab14 A C 4: 115,597,594 (GRCm39) D63A probably damaging Het
Ibtk T C 9: 85,585,143 (GRCm39) E1167G probably benign Het
Ikzf4 A T 10: 128,479,605 (GRCm39) probably benign Het
Magi3 T C 3: 103,958,277 (GRCm39) K603E probably damaging Het
Myh13 T C 11: 67,255,636 (GRCm39) probably benign Het
Nox4 A T 7: 87,046,032 (GRCm39) H557L possibly damaging Het
Oasl1 A G 5: 115,075,073 (GRCm39) K378E possibly damaging Het
Pdia3 A T 2: 121,244,596 (GRCm39) D26V probably damaging Het
Pds5a T C 5: 65,821,839 (GRCm39) T120A possibly damaging Het
Phf8-ps G A 17: 33,285,023 (GRCm39) T593I probably benign Het
Pkn2 G A 3: 142,509,325 (GRCm39) P740S probably benign Het
Pla2r1 A T 2: 60,252,966 (GRCm39) I1375K probably damaging Het
Pld2 T C 11: 70,432,253 (GRCm39) L124P probably damaging Het
Ppp6r3 T A 19: 3,562,037 (GRCm39) H208L probably damaging Het
Prr36 G T 8: 4,262,910 (GRCm39) Q919K probably benign Het
Ptprz1 T C 6: 23,022,204 (GRCm39) I844T possibly damaging Het
Rbl1 A G 2: 157,034,039 (GRCm39) probably benign Het
Sdk1 A G 5: 142,100,154 (GRCm39) I1395V probably benign Het
Senp7 C A 16: 55,973,832 (GRCm39) P351Q possibly damaging Het
Slc26a7 T C 4: 14,544,197 (GRCm39) T369A probably benign Het
Tnxb A G 17: 34,930,491 (GRCm39) T2059A probably damaging Het
Vat1l T A 8: 115,098,469 (GRCm39) M413K probably benign Het
Vps11 C G 9: 44,267,017 (GRCm39) G406A probably damaging Het
Wnk2 C T 13: 49,244,313 (GRCm39) D508N probably damaging Het
Other mutations in Ptpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Ptpn1 APN 2 167,809,712 (GRCm39) missense probably damaging 1.00
IGL02976:Ptpn1 APN 2 167,813,704 (GRCm39) missense probably benign 0.01
escondido UTSW 2 167,816,161 (GRCm39) missense probably damaging 1.00
R0106:Ptpn1 UTSW 2 167,818,338 (GRCm39) unclassified probably benign
R0106:Ptpn1 UTSW 2 167,818,338 (GRCm39) unclassified probably benign
R1438:Ptpn1 UTSW 2 167,818,529 (GRCm39) missense probably damaging 0.99
R3010:Ptpn1 UTSW 2 167,816,742 (GRCm39) missense probably damaging 1.00
R3607:Ptpn1 UTSW 2 167,817,427 (GRCm39) missense probably benign
R3755:Ptpn1 UTSW 2 167,816,143 (GRCm39) missense probably damaging 1.00
R4075:Ptpn1 UTSW 2 167,818,433 (GRCm39) splice site probably null
R4627:Ptpn1 UTSW 2 167,809,701 (GRCm39) missense probably benign 0.00
R4754:Ptpn1 UTSW 2 167,816,080 (GRCm39) missense probably damaging 1.00
R5596:Ptpn1 UTSW 2 167,816,683 (GRCm39) missense probably damaging 1.00
R5920:Ptpn1 UTSW 2 167,813,668 (GRCm39) missense probably benign 0.02
R6133:Ptpn1 UTSW 2 167,809,716 (GRCm39) missense possibly damaging 0.94
R7296:Ptpn1 UTSW 2 167,816,692 (GRCm39) missense probably damaging 0.98
R8350:Ptpn1 UTSW 2 167,816,161 (GRCm39) missense probably damaging 1.00
R9275:Ptpn1 UTSW 2 167,816,176 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACATGATGGGATGTGGGAC -3'
(R):5'- CCCTAGTGTGGTCTGTAATAAAAGTG -3'

Sequencing Primer
(F):5'- CCTTGGTGGGCTACTCTGC -3'
(R):5'- GGAGCTTTAAGAACTGGG -3'
Posted On 2015-05-14