Incidental Mutation 'R4088:Cep250'
ID317457
Institutional Source Beutler Lab
Gene Symbol Cep250
Ensembl Gene ENSMUSG00000038241
Gene Namecentrosomal protein 250
SynonymsCep2, Inmp, B230210E21Rik
MMRRC Submission 040981-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R4088 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location155956458-155998900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 155992632 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 2159 (R2159K)
Ref Sequence ENSEMBL: ENSMUSP00000105248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]
Predicted Effect probably damaging
Transcript: ENSMUST00000039994
AA Change: R2158K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: R2158K

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094421
AA Change: R2138K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: R2138K

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109619
AA Change: R2159K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: R2159K

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124812
Predicted Effect probably benign
Transcript: ENSMUST00000128683
SMART Domains Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
coiled coil region 2 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148191
Predicted Effect probably benign
Transcript: ENSMUST00000156355
SMART Domains Protein: ENSMUSP00000122223
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
coiled coil region 119 223 N/A INTRINSIC
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T C 1: 181,227,709 noncoding transcript Het
Alox12b G T 11: 69,158,385 V87L probably benign Het
Arsk T G 13: 76,098,414 N32T probably benign Het
Baz1b T A 5: 135,216,940 N414K probably damaging Het
Cacna1e A T 1: 154,412,183 probably null Het
Cdc73 A G 1: 143,608,514 probably benign Het
Cdhr2 A G 13: 54,717,888 D233G probably null Het
Col4a4 T A 1: 82,523,922 Y370F unknown Het
Cyp2b9 T C 7: 26,173,456 L8P probably damaging Het
Ddx4 A G 13: 112,613,761 V386A probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Dnajc6 T A 4: 101,639,396 V920E probably damaging Het
Eef2kmt A T 16: 5,253,035 I50N probably damaging Het
Esyt3 T C 9: 99,324,237 M40V probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gpr26 G T 7: 131,967,076 C50F probably benign Het
Hmcn1 A G 1: 150,703,216 I1993T possibly damaging Het
Hsdl2 T A 4: 59,610,636 L211Q unknown Het
Khdrbs2 A G 1: 32,333,524 E93G probably damaging Het
Kif13b T C 14: 64,767,455 probably null Het
Kif15 T A 9: 122,986,189 L423I probably benign Het
Kmt2c A G 5: 25,287,713 V834A probably benign Het
Lama3 T A 18: 12,504,308 Y28* probably null Het
Map4k2 A T 19: 6,353,156 H763L probably damaging Het
Mkl2 T C 16: 13,384,200 F120S probably damaging Het
Ndufs3 C T 2: 90,898,345 probably benign Het
Nfasc A T 1: 132,595,591 V887E probably damaging Het
Npsr1 G A 9: 24,313,769 E358K possibly damaging Het
Nrcam T C 12: 44,572,202 L828P possibly damaging Het
Olfr344 T A 2: 36,569,018 L140H probably damaging Het
Oprm1 T C 10: 6,830,234 Y299H probably damaging Het
Osbpl8 T C 10: 111,289,790 V777A possibly damaging Het
Pcnt T C 10: 76,428,014 E372G probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Sbk2 T C 7: 4,957,628 Y181C probably damaging Het
Sf1 G A 19: 6,368,440 probably null Het
Slc26a9 A G 1: 131,767,849 E765G possibly damaging Het
Stab2 A G 10: 86,922,185 L1073P probably damaging Het
Sypl2 A G 3: 108,217,676 I123T possibly damaging Het
Taar3 A G 10: 23,949,859 D101G possibly damaging Het
Thsd4 T C 9: 59,997,222 R204G probably benign Het
Traf3ip3 A G 1: 193,181,320 V414A probably damaging Het
Trim14 T A 4: 46,523,709 T110S probably benign Het
Trim65 G A 11: 116,126,479 Q386* probably null Het
Ttn G A 2: 76,917,770 Q4312* probably null Het
Ubtfl1 T C 9: 18,409,968 V264A probably damaging Het
Vmn1r58 C A 7: 5,410,655 W192L probably damaging Het
Washc5 C A 15: 59,339,862 C969F probably damaging Het
Zdhhc14 A G 17: 5,726,856 K296R probably benign Het
Zfp281 T A 1: 136,626,121 I279N probably damaging Het
Zfp9 G T 6: 118,464,769 P311T probably damaging Het
Other mutations in Cep250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Cep250 APN 2 155991329 missense probably benign 0.00
IGL01077:Cep250 APN 2 155962134 missense probably damaging 1.00
IGL01084:Cep250 APN 2 155998393 missense probably benign 0.00
IGL01400:Cep250 APN 2 155998291 missense possibly damaging 0.78
IGL01570:Cep250 APN 2 155967663 splice site probably benign
IGL01583:Cep250 APN 2 155976149 missense probably damaging 0.99
IGL01590:Cep250 APN 2 155992317 missense possibly damaging 0.80
IGL01647:Cep250 APN 2 155983376 missense probably benign 0.02
IGL01959:Cep250 APN 2 155983359 missense possibly damaging 0.63
IGL02066:Cep250 APN 2 155976521 missense probably damaging 1.00
IGL02219:Cep250 APN 2 155991594 missense probably benign 0.26
IGL02322:Cep250 APN 2 155990328 missense probably damaging 1.00
IGL02728:Cep250 APN 2 155983278 unclassified probably benign
IGL02955:Cep250 APN 2 155975756 missense probably benign 0.01
IGL03369:Cep250 APN 2 155990271 missense probably benign 0.00
R0366:Cep250 UTSW 2 155988401 missense probably benign 0.00
R0403:Cep250 UTSW 2 155992349 missense probably damaging 0.99
R0441:Cep250 UTSW 2 155972004 missense possibly damaging 0.82
R0482:Cep250 UTSW 2 155964974 splice site probably benign
R0507:Cep250 UTSW 2 155992532 missense possibly damaging 0.60
R0614:Cep250 UTSW 2 155970097 nonsense probably null
R0855:Cep250 UTSW 2 155964111 missense probably damaging 1.00
R0973:Cep250 UTSW 2 155964289 splice site probably benign
R1137:Cep250 UTSW 2 155990840 missense probably benign 0.05
R1270:Cep250 UTSW 2 155990681 missense probably benign 0.01
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1313:Cep250 UTSW 2 155972079 missense probably damaging 0.98
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1470:Cep250 UTSW 2 155991075 missense probably damaging 0.99
R1703:Cep250 UTSW 2 155965546 missense probably benign 0.23
R1705:Cep250 UTSW 2 155963786 missense probably damaging 1.00
R1740:Cep250 UTSW 2 155973356 missense probably damaging 0.99
R1796:Cep250 UTSW 2 155992187 missense possibly damaging 0.88
R1897:Cep250 UTSW 2 155976095 missense probably damaging 1.00
R1900:Cep250 UTSW 2 155985374 critical splice donor site probably null
R1958:Cep250 UTSW 2 155976381 splice site probably null
R1974:Cep250 UTSW 2 155989504 missense probably damaging 0.96
R2015:Cep250 UTSW 2 155981453 missense probably damaging 0.96
R2033:Cep250 UTSW 2 155970892 missense probably damaging 0.99
R2224:Cep250 UTSW 2 155991817 missense possibly damaging 0.94
R2266:Cep250 UTSW 2 155976170 missense probably benign 0.13
R2278:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2332:Cep250 UTSW 2 155990607 missense probably damaging 1.00
R2364:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2366:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2367:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R2385:Cep250 UTSW 2 155974341 missense probably damaging 1.00
R2830:Cep250 UTSW 2 155983316 missense probably benign 0.00
R2895:Cep250 UTSW 2 155992122 missense probably benign 0.00
R2965:Cep250 UTSW 2 155994878 missense probably benign 0.44
R2966:Cep250 UTSW 2 155994878 missense probably benign 0.44
R3016:Cep250 UTSW 2 155991288 missense probably damaging 1.00
R3052:Cep250 UTSW 2 155991048 missense probably damaging 0.99
R3424:Cep250 UTSW 2 155981461 missense probably benign 0.02
R3930:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4085:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4087:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4090:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4110:Cep250 UTSW 2 155992632 missense probably damaging 1.00
R4355:Cep250 UTSW 2 155991525 missense probably damaging 1.00
R4601:Cep250 UTSW 2 155962053 missense probably benign 0.10
R4721:Cep250 UTSW 2 155970199 missense probably damaging 1.00
R4995:Cep250 UTSW 2 155988316 missense probably damaging 1.00
R5053:Cep250 UTSW 2 155962928 missense possibly damaging 0.77
R5090:Cep250 UTSW 2 155976404 missense probably damaging 1.00
R5744:Cep250 UTSW 2 155981474 missense possibly damaging 0.60
R5775:Cep250 UTSW 2 155969374 missense possibly damaging 0.92
R5986:Cep250 UTSW 2 155979277 missense probably damaging 1.00
R6112:Cep250 UTSW 2 155994583 missense possibly damaging 0.95
R6152:Cep250 UTSW 2 155981438 missense possibly damaging 0.94
R6823:Cep250 UTSW 2 155981459 missense probably benign 0.02
R6859:Cep250 UTSW 2 155992526 missense probably benign 0.24
R6900:Cep250 UTSW 2 155996270 critical splice acceptor site probably null
R7107:Cep250 UTSW 2 155995394 missense probably benign 0.00
R7131:Cep250 UTSW 2 155965077 missense probably damaging 1.00
R7178:Cep250 UTSW 2 155973455 nonsense probably null
R7241:Cep250 UTSW 2 155991552 missense probably benign 0.20
R7264:Cep250 UTSW 2 155979151 missense probably damaging 0.99
R7290:Cep250 UTSW 2 155992762 missense probably benign 0.03
X0061:Cep250 UTSW 2 155961985 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGCCTAAAGGAGCTACAGC -3'
(R):5'- ACTCTCTGAGGTACCACAGG -3'

Sequencing Primer
(F):5'- CAGCTGACTGTAGCCCAAAGG -3'
(R):5'- CCCTTGAGCTCAGCCAATG -3'
Posted On2015-05-15