Incidental Mutation 'R4168:Gm12789'
ID320648
Institutional Source Beutler Lab
Gene Symbol Gm12789
Ensembl Gene ENSMUSG00000078625
Gene Namepredicted gene 12789
Synonyms
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101986626-101990053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101989962 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 148 (Y148C)
Ref Sequence ENSEMBL: ENSMUSP00000102528 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000106914
AA Change: Y148C

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000106915
AA Change: Y148C

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151553
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Pla2r1 A T 2: 60,497,614 Y501* probably null Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Gm12789
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0267:Gm12789 UTSW 4 101988122 missense probably benign 0.03
R1282:Gm12789 UTSW 4 101988290 missense probably damaging 1.00
R1551:Gm12789 UTSW 4 101988934 missense probably benign 0.08
R2039:Gm12789 UTSW 4 101988986 splice site probably benign
R4090:Gm12789 UTSW 4 101988329 missense possibly damaging 0.78
R4585:Gm12789 UTSW 4 101989962 missense possibly damaging 0.50
R4817:Gm12789 UTSW 4 101988882 missense probably damaging 0.99
R4866:Gm12789 UTSW 4 101988985 splice site probably benign
R4900:Gm12789 UTSW 4 101988985 splice site probably benign
R5429:Gm12789 UTSW 4 101989961 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCATGACCTTGACAGAGTCAC -3'
(R):5'- AAAATGGTTGGCTTGCCCTC -3'

Sequencing Primer
(F):5'- CTGACCTCAGTTCTTGGTTTACC -3'
(R):5'- CTCTCTCTGAGCTCACAATTGAAGAG -3'
Posted On2015-06-12