Incidental Mutation 'R4168:Pla2r1'
ID320643
Institutional Source Beutler Lab
Gene Symbol Pla2r1
Ensembl Gene ENSMUSG00000054580
Gene Namephospholipase A2 receptor 1
SynonymsM-type receptor, Pla2g1br, PLA2-I receptor
MMRRC Submission 041009-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4168 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60417543-60553308 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 60497614 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 501 (Y501*)
Ref Sequence ENSEMBL: ENSMUSP00000108144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112525]
Predicted Effect probably null
Transcript: ENSMUST00000067708
AA Change: Y501*
SMART Domains Protein: ENSMUSP00000065205
Gene: ENSMUSG00000054580
AA Change: Y501*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
RICIN 42 154 2.98e-16 SMART
FN2 174 222 1.17e-25 SMART
CLECT 232 357 7.66e-30 SMART
CLECT 380 504 1.88e-29 SMART
CLECT 517 644 5.42e-21 SMART
CLECT 664 797 3.58e-21 SMART
CLECT 812 938 7.55e-20 SMART
CLECT 957 1096 5.05e-30 SMART
CLECT 1113 1232 4.72e-21 SMART
CLECT 1246 1377 1.44e-25 SMART
transmembrane domain 1397 1419 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112525
AA Change: Y501*
SMART Domains Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: Y501*

DomainStartEndE-ValueType
low complexity region 35 62 N/A INTRINSIC
RICIN 77 189 2.98e-16 SMART
FN2 209 257 1.17e-25 SMART
CLECT 267 392 7.66e-30 SMART
CLECT 415 539 1.88e-29 SMART
CLECT 552 679 5.42e-21 SMART
CLECT 699 832 3.58e-21 SMART
CLECT 847 973 7.55e-20 SMART
CLECT 992 1131 5.05e-30 SMART
CLECT 1148 1267 4.72e-21 SMART
CLECT 1281 1412 1.44e-25 SMART
transmembrane domain 1432 1454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128208
Meta Mutation Damage Score 0.64 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,137,109 L151P probably benign Het
C3 A T 17: 57,218,608 F883I probably benign Het
Cbr4 T A 8: 61,491,521 probably benign Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Chpf2 T C 5: 24,591,790 V578A possibly damaging Het
Clasrp A G 7: 19,581,154 probably benign Het
Cmip A T 8: 117,456,917 N743I probably damaging Het
Ctif A C 18: 75,637,215 L33R probably damaging Het
Dmap1 T A 4: 117,681,310 H54L possibly damaging Het
Elk3 A G 10: 93,265,335 probably null Het
Flt4 G A 11: 49,630,573 R440H probably benign Het
Gabrb2 A T 11: 42,421,328 probably benign Het
Gm12789 A G 4: 101,989,962 Y148C possibly damaging Het
Gm5724 T C 6: 141,738,947 I261V probably benign Het
Haspin A G 11: 73,136,022 L747P probably damaging Het
Intu C T 3: 40,672,623 P278L probably benign Het
Kif27 A G 13: 58,345,748 I127T probably benign Het
Mogat1 T C 1: 78,512,035 V25A possibly damaging Het
Nop14 A G 5: 34,656,744 S157P probably damaging Het
Olfr1040 A G 2: 86,146,179 I185T probably benign Het
Olfr1167 T C 2: 88,149,845 H58R probably damaging Het
Olfr195 A T 16: 59,149,000 Y50F probably benign Het
Oxct2b T C 4: 123,117,685 L466P probably damaging Het
Padi6 A G 4: 140,741,934 C32R probably damaging Het
Rb1cc1 G A 1: 6,230,024 V8I probably damaging Het
Rexo5 A G 7: 119,827,398 probably benign Het
Tmem119 T C 5: 113,794,987 E251G probably benign Het
Vmn2r112 T A 17: 22,603,088 M249K probably benign Het
Zc2hc1a A G 3: 7,518,391 T41A probably benign Het
Zfp128 A G 7: 12,890,362 D219G probably benign Het
Znrf2 T C 6: 54,863,960 V173A possibly damaging Het
Other mutations in Pla2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Pla2r1 APN 2 60420425 missense probably benign
IGL00886:Pla2r1 APN 2 60424324 missense probably damaging 1.00
IGL00928:Pla2r1 APN 2 60535080 missense probably damaging 0.99
IGL01361:Pla2r1 APN 2 60479470 missense probably damaging 1.00
IGL01403:Pla2r1 APN 2 60424288 missense probably damaging 0.99
IGL01475:Pla2r1 APN 2 60441081 splice site probably benign
IGL01517:Pla2r1 APN 2 60504253 missense probably damaging 1.00
IGL01646:Pla2r1 APN 2 60495364 missense probably damaging 1.00
IGL02208:Pla2r1 APN 2 60428588 missense possibly damaging 0.81
IGL02301:Pla2r1 APN 2 60452436 missense probably benign 0.01
IGL02522:Pla2r1 APN 2 60428669 missense probably benign 0.11
IGL02688:Pla2r1 APN 2 60455201 missense probably damaging 1.00
IGL02822:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02850:Pla2r1 APN 2 60502069 missense probably benign 0.03
IGL03233:Pla2r1 APN 2 60428580 missense possibly damaging 0.63
IGL03350:Pla2r1 APN 2 60455173 missense probably damaging 1.00
IGL02980:Pla2r1 UTSW 2 60515046 missense possibly damaging 0.77
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0105:Pla2r1 UTSW 2 60514981 missense possibly damaging 0.89
R0387:Pla2r1 UTSW 2 60432601 missense probably benign 0.03
R0522:Pla2r1 UTSW 2 60479515 missense probably benign 0.01
R0550:Pla2r1 UTSW 2 60425350 critical splice donor site probably null
R0718:Pla2r1 UTSW 2 60479530 missense possibly damaging 0.55
R0906:Pla2r1 UTSW 2 60514947 missense possibly damaging 0.79
R0945:Pla2r1 UTSW 2 60458410 missense possibly damaging 0.89
R1229:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1397:Pla2r1 UTSW 2 60534762 missense probably benign 0.09
R1667:Pla2r1 UTSW 2 60420257 missense probably benign 0.00
R1668:Pla2r1 UTSW 2 60428646 missense probably damaging 0.99
R1694:Pla2r1 UTSW 2 60441084 critical splice donor site probably null
R1864:Pla2r1 UTSW 2 60428711 missense probably benign 0.01
R2029:Pla2r1 UTSW 2 60431973 missense probably damaging 0.99
R2035:Pla2r1 UTSW 2 60422736 missense probably damaging 1.00
R2207:Pla2r1 UTSW 2 60458435 missense probably damaging 1.00
R2429:Pla2r1 UTSW 2 60514968 missense probably damaging 1.00
R3196:Pla2r1 UTSW 2 60522783 missense probably damaging 1.00
R3522:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R3973:Pla2r1 UTSW 2 60448962 missense probably benign 0.30
R4006:Pla2r1 UTSW 2 60522873 missense probably damaging 1.00
R4091:Pla2r1 UTSW 2 60432593 missense probably damaging 1.00
R4158:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4160:Pla2r1 UTSW 2 60422622 missense probably damaging 0.97
R4541:Pla2r1 UTSW 2 60427738 missense probably damaging 1.00
R4712:Pla2r1 UTSW 2 60428650 missense probably damaging 1.00
R4797:Pla2r1 UTSW 2 60504180 missense possibly damaging 0.47
R4884:Pla2r1 UTSW 2 60534984 missense probably damaging 1.00
R4923:Pla2r1 UTSW 2 60422712 missense probably benign 0.31
R5017:Pla2r1 UTSW 2 60522760 splice site probably null
R5116:Pla2r1 UTSW 2 60448906 missense probably damaging 1.00
R5641:Pla2r1 UTSW 2 60514984 missense probably damaging 1.00
R5807:Pla2r1 UTSW 2 60428721 missense possibly damaging 0.78
R5898:Pla2r1 UTSW 2 60422760 missense probably damaging 1.00
R6241:Pla2r1 UTSW 2 60502199 splice site probably null
R6923:Pla2r1 UTSW 2 60514966 missense probably benign 0.11
R7020:Pla2r1 UTSW 2 60447399 missense possibly damaging 0.79
R7028:Pla2r1 UTSW 2 60458393 missense probably damaging 0.98
R7257:Pla2r1 UTSW 2 60427625 critical splice donor site probably null
R7291:Pla2r1 UTSW 2 60530435 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCCCAAAATTACTCAGCGGG -3'
(R):5'- TACCAGGCTGTTGTGTGAC -3'

Sequencing Primer
(F):5'- CCTGGAACTTGCTATAGAGTTCAG -3'
(R):5'- TGACCATGCAGGGTTCTGGAAC -3'
Posted On2015-06-12