Incidental Mutation 'R4108:4930579F01Rik'
ID321459
Institutional Source Beutler Lab
Gene Symbol 4930579F01Rik
Ensembl Gene ENSMUSG00000012042
Gene NameRIKEN cDNA 4930579F01 gene
Synonyms
MMRRC Submission 040987-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4108 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138164078-138193825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138183670 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 62 (N62S)
Ref Sequence ENSEMBL: ENSMUSP00000012186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012186] [ENSMUST00000199293]
Predicted Effect probably benign
Transcript: ENSMUST00000012186
AA Change: N62S

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000012186
Gene: ENSMUSG00000012042
AA Change: N62S

DomainStartEndE-ValueType
Pfam:SPATIAL 17 201 1.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199293
SMART Domains Protein: ENSMUSP00000142940
Gene: ENSMUSG00000012042

DomainStartEndE-ValueType
Pfam:SPATIAL 1 76 9.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199804
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (65/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik A G 10: 87,225,934 Y82C probably damaging Het
Acad10 G T 5: 121,631,464 S643Y probably damaging Het
Acox3 T C 5: 35,601,552 F369S probably damaging Het
Arhgap31 A G 16: 38,602,426 S1093P probably damaging Het
Atp4b A G 8: 13,396,640 probably null Het
Bmper G A 9: 23,224,763 V47I probably benign Het
Caskin1 C A 17: 24,502,147 T487K probably benign Het
Ccr7 C T 11: 99,145,378 M239I probably damaging Het
Cdh23 C A 10: 60,410,822 V944L possibly damaging Het
Cenpf A G 1: 189,683,868 S87P probably damaging Het
Chd9 A T 8: 91,010,676 D1461V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyb5r2 A T 7: 107,753,929 M102K probably damaging Het
Cyp2j7 T C 4: 96,199,450 T408A possibly damaging Het
Dnajb2 G T 1: 75,236,899 E6* probably null Het
Dtx4 G A 19: 12,501,123 A32V probably damaging Het
Eml5 T C 12: 98,841,548 probably null Het
Eml6 A C 11: 29,805,136 S880A probably damaging Het
Fsd2 C T 7: 81,544,967 V483I probably benign Het
Inf2 T C 12: 112,607,581 L773P unknown Het
Kif26b A G 1: 178,916,965 Q1095R possibly damaging Het
Leprotl1 A G 8: 34,140,759 probably null Het
Lrp1b A G 2: 40,665,087 V340A unknown Het
Myh1 T C 11: 67,211,577 V898A probably benign Het
Ncstn G T 1: 172,072,544 N254K probably damaging Het
Nfatc1 T A 18: 80,698,368 H139L possibly damaging Het
Nfe2l1 C T 11: 96,819,394 probably null Het
Nfya G T 17: 48,392,884 Y37* probably null Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr11 A G 13: 21,638,782 V247A probably damaging Het
Olfr844 T A 9: 19,319,312 Y265* probably null Het
Otogl C T 10: 107,771,244 V2093I probably benign Het
Phc2 A G 4: 128,707,983 Y77C probably damaging Het
Pik3c2g C A 6: 139,730,370 A80E probably benign Het
Plxnd1 G T 6: 115,959,315 H1675N probably damaging Het
Pou4f3 A G 18: 42,395,922 K310R probably damaging Het
Ppp1r12c T C 7: 4,486,566 D199G probably damaging Het
Prss22 A G 17: 23,993,873 Y297H probably benign Het
Psmb7 T A 2: 38,642,199 H78L probably damaging Het
Rad51ap2 T C 12: 11,458,395 C773R probably damaging Het
Rpl12 A T 2: 32,961,824 N8Y probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sbf1 T C 15: 89,288,585 probably benign Het
Scn3a A G 2: 65,495,035 I1046T probably benign Het
Setd1a G A 7: 127,799,202 probably benign Het
Slc15a2 G T 16: 36,782,393 probably benign Het
Slc34a2 G A 5: 53,064,009 V266I possibly damaging Het
Smtn G A 11: 3,526,449 T144I probably benign Het
Spta1 A G 1: 174,174,556 N84S probably benign Het
Sult6b1 G T 17: 78,906,862 T6N probably damaging Het
Supt16 T C 14: 52,162,731 E985G probably damaging Het
Tbcd T A 11: 121,493,811 H39Q probably benign Het
Tpo G A 12: 30,092,586 P713L probably damaging Het
Tsg101 T A 7: 46,892,494 D99V probably damaging Het
Ttn G C 2: 76,750,871 A23226G probably damaging Het
Ttn C T 2: 76,778,465 V15990I probably benign Het
Ubald1 C A 16: 4,875,867 M61I probably benign Het
Ush1c C T 7: 46,198,445 D465N probably damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps54 A G 11: 21,312,877 I655V probably benign Het
Other mutations in 4930579F01Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:4930579F01Rik APN 3 138186198 intron probably benign
IGL02121:4930579F01Rik APN 3 138164373 missense possibly damaging 0.93
IGL02424:4930579F01Rik APN 3 138174705 splice site probably benign
R0008:4930579F01Rik UTSW 3 138176585 missense possibly damaging 0.67
R0008:4930579F01Rik UTSW 3 138176585 missense possibly damaging 0.67
R0373:4930579F01Rik UTSW 3 138173582 missense probably damaging 0.96
R1082:4930579F01Rik UTSW 3 138173571 missense possibly damaging 0.95
R1163:4930579F01Rik UTSW 3 138176510 missense probably damaging 1.00
R1538:4930579F01Rik UTSW 3 138183756 missense probably damaging 1.00
R2151:4930579F01Rik UTSW 3 138176456 critical splice donor site probably null
R2364:4930579F01Rik UTSW 3 138165823 missense probably benign 0.00
R3978:4930579F01Rik UTSW 3 138183674 missense probably benign 0.01
R5812:4930579F01Rik UTSW 3 138176538 missense probably damaging 1.00
R5960:4930579F01Rik UTSW 3 138183767 missense possibly damaging 0.58
R6329:4930579F01Rik UTSW 3 138173696 missense probably damaging 1.00
R6599:4930579F01Rik UTSW 3 138176489 missense probably benign 0.00
R6862:4930579F01Rik UTSW 3 138186188 intron probably benign
R6897:4930579F01Rik UTSW 3 138183773 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCGACAGCAGATTTAAGCAAGC -3'
(R):5'- ACTCTAGTGGGAAGTACTGGG -3'

Sequencing Primer
(F):5'- TTAAGCAAGCAGATTTCCTCCAGTC -3'
(R):5'- GTGACACATGTGTTCTGAACAG -3'
Posted On2015-06-12