Incidental Mutation 'R4379:Qser1'
ID325225
Institutional Source Beutler Lab
Gene Symbol Qser1
Ensembl Gene ENSMUSG00000074994
Gene Nameglutamine and serine rich 1
Synonyms4732486I23Rik
MMRRC Submission 041677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4379 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104754795-104816760 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 104766059 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117237] [ENSMUST00000231375]
Predicted Effect probably null
Transcript: ENSMUST00000117237
SMART Domains Protein: ENSMUSP00000114062
Gene: ENSMUSG00000074994

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 196 209 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 532 550 N/A INTRINSIC
low complexity region 697 713 N/A INTRINSIC
low complexity region 1037 1050 N/A INTRINSIC
low complexity region 1420 1449 N/A INTRINSIC
Pfam:DUF4211 1470 1616 1e-26 PFAM
low complexity region 1631 1647 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000231375
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 95% (53/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,865,875 H1252Q probably benign Het
Adcy3 T C 12: 4,134,558 L78P probably damaging Het
Agmat G T 4: 141,757,491 A282S probably benign Het
Akap8 G T 17: 32,306,560 T515K probably damaging Het
Akap8l T C 17: 32,321,514 probably benign Het
Alpk1 C T 3: 127,729,373 V7M probably damaging Het
AW209491 T C 13: 14,637,827 *422Q probably null Het
Cdan1 A G 2: 120,726,618 F576L probably damaging Het
Cers5 A G 15: 99,751,253 F45L probably damaging Het
Dst T C 1: 34,163,235 S215P probably damaging Het
Dst A G 1: 34,227,975 I5011V probably benign Het
En1 A G 1: 120,603,355 N108S possibly damaging Het
Fam189b A T 3: 89,185,757 D274V probably damaging Het
Fancd2 T C 6: 113,561,716 S591P probably benign Het
Glt1d1 T C 5: 127,694,282 V279A possibly damaging Het
Gm10051 C T 5: 133,475,448 noncoding transcript Het
Gpr158 G T 2: 21,825,214 G690V probably damaging Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Grm7 T A 6: 111,246,374 N458K probably benign Het
Hibadh G A 6: 52,620,042 S139L probably damaging Het
Hivep1 C T 13: 42,155,430 S382F probably damaging Het
Ift74 A G 4: 94,679,934 N403D probably benign Het
Igkv4-81 A G 6: 68,990,949 L56S probably damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lmbr1l G T 15: 98,909,263 C212* probably null Het
Lrp10 C T 14: 54,468,366 R338C probably damaging Het
Lrrc34 A G 3: 30,631,375 L275P probably damaging Het
Mgam2-ps T C 6: 40,833,859 noncoding transcript Het
Mief1 T G 15: 80,247,959 M77R possibly damaging Het
Neurod6 T C 6: 55,679,272 T127A probably damaging Het
Nif3l1 A C 1: 58,455,579 probably benign Het
Nlrp12 T A 7: 3,239,924 T653S probably benign Het
Nol7 G T 13: 43,401,575 W228L probably damaging Het
Nrp1 G A 8: 128,468,467 R468H probably damaging Het
Olfr194 C T 16: 59,119,664 M135I probably benign Het
Olfr854 A G 9: 19,566,742 L211P probably benign Het
Pbrm1 A T 14: 31,067,706 H785L probably damaging Het
Pus7 T C 5: 23,748,866 probably benign Het
Rrm1 T C 7: 102,446,593 V51A probably damaging Het
Setbp1 T C 18: 79,086,681 N112S probably damaging Het
Svil C T 18: 5,046,909 H52Y probably damaging Het
Taf1d T A 9: 15,311,981 probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Treml1 A G 17: 48,360,396 Y103C probably damaging Het
Trim28 A T 7: 13,029,480 D516V probably damaging Het
Usp34 T A 11: 23,384,499 N1164K possibly damaging Het
Vmn2r115 A G 17: 23,345,223 Y123C possibly damaging Het
Vrk3 C T 7: 44,775,442 T427M probably benign Het
Zfp28 C T 7: 6,393,442 T292I probably benign Het
Zmynd8 A T 2: 165,807,938 probably null Het
Zscan4d A G 7: 11,164,978 V124A probably benign Het
Other mutations in Qser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Qser1 APN 2 104766056 missense probably damaging 1.00
IGL00402:Qser1 APN 2 104786981 missense probably benign 0.00
IGL00417:Qser1 APN 2 104786903 missense probably damaging 1.00
IGL00756:Qser1 APN 2 104787671 missense possibly damaging 0.55
IGL01304:Qser1 APN 2 104787631 missense probably damaging 0.99
IGL01317:Qser1 APN 2 104786979 missense probably damaging 0.99
IGL02186:Qser1 APN 2 104788261 missense probably damaging 1.00
IGL03236:Qser1 APN 2 104786532 missense probably benign 0.35
IGL03365:Qser1 APN 2 104786999 missense probably damaging 1.00
behoove UTSW 2 104786977 nonsense probably null
I1329:Qser1 UTSW 2 104786977 nonsense probably null
R0270:Qser1 UTSW 2 104788961 missense probably benign 0.03
R0395:Qser1 UTSW 2 104762881 missense probably damaging 1.00
R0523:Qser1 UTSW 2 104789676 missense probably damaging 1.00
R0727:Qser1 UTSW 2 104777311 splice site probably benign
R1037:Qser1 UTSW 2 104760555 missense probably damaging 0.99
R1222:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1418:Qser1 UTSW 2 104777431 missense probably damaging 1.00
R1891:Qser1 UTSW 2 104790099 missense probably benign
R1974:Qser1 UTSW 2 104760541 missense probably damaging 1.00
R2200:Qser1 UTSW 2 104789013 missense probably damaging 1.00
R4179:Qser1 UTSW 2 104776384 missense probably benign 0.19
R4418:Qser1 UTSW 2 104789421 missense probably damaging 1.00
R4585:Qser1 UTSW 2 104786793 missense probably benign 0.01
R4697:Qser1 UTSW 2 104787183 missense probably benign 0.00
R4749:Qser1 UTSW 2 104787304 missense probably benign 0.16
R4775:Qser1 UTSW 2 104789901 missense probably damaging 1.00
R5010:Qser1 UTSW 2 104787831 missense possibly damaging 0.67
R5070:Qser1 UTSW 2 104787282 missense possibly damaging 0.49
R5268:Qser1 UTSW 2 104787431 missense possibly damaging 0.47
R5384:Qser1 UTSW 2 104786642 missense probably damaging 1.00
R5400:Qser1 UTSW 2 104789874 missense probably damaging 1.00
R5502:Qser1 UTSW 2 104786574 missense probably benign 0.00
R5615:Qser1 UTSW 2 104789694 missense possibly damaging 0.78
R5664:Qser1 UTSW 2 104778196 missense probably damaging 1.00
R5750:Qser1 UTSW 2 104788923 missense probably damaging 1.00
R5793:Qser1 UTSW 2 104762860 missense probably damaging 1.00
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6035:Qser1 UTSW 2 104787123 missense probably damaging 0.99
R6171:Qser1 UTSW 2 104789283 missense probably damaging 1.00
R6223:Qser1 UTSW 2 104787648 missense probably benign 0.01
R6254:Qser1 UTSW 2 104790090 missense probably benign 0.07
R6303:Qser1 UTSW 2 104762830 missense probably damaging 1.00
R6653:Qser1 UTSW 2 104780260 missense possibly damaging 0.85
R6703:Qser1 UTSW 2 104777325 missense possibly damaging 0.50
R6970:Qser1 UTSW 2 104788130 missense probably benign 0.25
T0722:Qser1 UTSW 2 104786832 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CGAAGTCAGAACACCTAGTTAGCTC -3'
(R):5'- ACACCTTCATATAGGCAAAAGGGAG -3'

Sequencing Primer
(F):5'- AGAACACCTAGTTAGCTCTTCTTTC -3'
(R):5'- CTTCATATAGGCAAAAGGGAGAGGGG -3'
Posted On2015-07-06