Incidental Mutation 'R4419:Heg1'
ID327020
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
MMRRC Submission 041140-MU
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4419 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33727435 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 864 (E864V)
Ref Sequence ENSEMBL: ENSMUSP00000155944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect probably benign
Transcript: ENSMUST00000126532
AA Change: E888V

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: E888V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132797
Predicted Effect probably benign
Transcript: ENSMUST00000152782
AA Change: E633V

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254
AA Change: E633V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154863
Predicted Effect probably benign
Transcript: ENSMUST00000232568
AA Change: E864V

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amdhd2 G A 17: 24,158,678 P126L probably benign Het
Arfip2 T C 7: 105,639,063 T44A probably damaging Het
B4galt1 A G 4: 40,853,537 V90A probably benign Het
Bad C A 19: 6,950,685 A115E probably benign Het
Bicc1 A G 10: 70,946,974 L521P possibly damaging Het
Caskin1 T C 17: 24,504,709 S824P probably damaging Het
Cblb T A 16: 52,047,258 D76E possibly damaging Het
Celsr3 G T 9: 108,843,244 A2572S possibly damaging Het
Csmd3 T C 15: 47,704,311 Q2152R probably damaging Het
D2hgdh T A 1: 93,829,813 V150E probably damaging Het
Ddn C A 15: 98,805,611 W600L probably benign Het
Dicer1 A T 12: 104,705,114 Y966N probably damaging Het
Dsp T A 13: 38,195,132 I1352N probably damaging Het
Duox1 G A 2: 122,327,126 A578T probably benign Het
Dysf T C 6: 84,207,242 probably null Het
Elmo2 T C 2: 165,311,755 probably null Het
Hoxb9 T C 11: 96,271,981 V147A probably benign Het
Kdm1b C T 13: 47,063,077 R308W probably damaging Het
Ky G A 9: 102,542,710 V639I probably damaging Het
Med16 G A 10: 79,898,382 A566V probably benign Het
Mettl17 G T 14: 51,887,272 G167C possibly damaging Het
Mgat4b T C 11: 50,232,986 F318L probably damaging Het
Mug2 C A 6: 122,079,630 A1178D probably damaging Het
Myo3b A G 2: 70,096,362 D51G probably damaging Het
Naip2 T C 13: 100,160,625 N968D probably benign Het
Nbea T C 3: 56,009,600 H820R probably damaging Het
Nqo1 C T 8: 107,392,117 probably null Het
Olfr1328 A T 4: 118,934,389 I153N possibly damaging Het
Olfr780 T C 10: 129,321,815 F64S possibly damaging Het
Olfr916 C T 9: 38,658,069 V108I probably benign Het
Ppargc1a T C 5: 51,494,702 D218G probably damaging Het
Rras A G 7: 45,020,579 D145G probably damaging Het
Scn3a C A 2: 65,466,960 G1452C probably damaging Het
Slc22a2 C A 17: 12,612,586 S421* probably null Het
Slc39a10 A G 1: 46,810,066 F797L probably benign Het
Spta1 T A 1: 174,247,424 Y2405* probably null Het
Ss18 A G 18: 14,633,605 Y359H unknown Het
St14 C T 9: 31,096,928 C537Y probably damaging Het
Tmem252 T A 19: 24,677,546 Y96N probably damaging Het
Trafd1 T C 5: 121,373,333 D474G probably benign Het
Trmt1l A G 1: 151,440,808 I20M probably damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vmn1r43 A G 6: 89,869,647 S286P probably benign Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R0942:Heg1 UTSW 16 33760803 missense probably damaging 1.00
R1084:Heg1 UTSW 16 33706997 missense probably benign 0.26
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2068:Heg1 UTSW 16 33727590 missense probably benign 0.14
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5227:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGACCAGTCCCAGTACTCTG -3'
(R):5'- TGCCCTTTACCTGGGGTTAG -3'

Sequencing Primer
(F):5'- TCCCAGTACTCTGTCACATGTAGAAG -3'
(R):5'- CCCTTTACCTGGGGTTAGAGGTG -3'
Posted On2015-07-07