Incidental Mutation 'R2068:Heg1'
ID226889
Institutional Source Beutler Lab
Gene Symbol Heg1
Ensembl Gene ENSMUSG00000075254
Gene Nameheart development protein with EGF-like domains 1
Synonyms5530401I02Rik, 9530025L16Rik, LOC268884, 4632417D23Rik
MMRRC Submission 040073-MU
Accession Numbers

Genbank: NM_175256.5

Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R2068 (G1)
Quality Score109
Status Not validated
Chromosome16
Chromosomal Location33684370-33771576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33727590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 916 (T916A)
Ref Sequence ENSEMBL: ENSMUSP00000155944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126532] [ENSMUST00000152782] [ENSMUST00000232568]
Predicted Effect probably benign
Transcript: ENSMUST00000126532
AA Change: T940A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119790
Gene: ENSMUSG00000075254
AA Change: T940A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 471 480 N/A INTRINSIC
low complexity region 486 502 N/A INTRINSIC
low complexity region 556 575 N/A INTRINSIC
low complexity region 637 682 N/A INTRINSIC
low complexity region 868 888 N/A INTRINSIC
EGF 944 979 4e-5 SMART
EGF_CA 981 1019 1.01e-10 SMART
EGF_like 1139 1187 6.81e1 SMART
transmembrane domain 1204 1226 N/A INTRINSIC
PDB:4HDQ|C 1312 1337 2e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132797
Predicted Effect probably benign
Transcript: ENSMUST00000152782
AA Change: T685A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123686
Gene: ENSMUSG00000075254
AA Change: T685A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
low complexity region 68 104 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 185 202 N/A INTRINSIC
low complexity region 301 320 N/A INTRINSIC
low complexity region 382 427 N/A INTRINSIC
low complexity region 613 633 N/A INTRINSIC
EGF 689 724 4e-5 SMART
EGF_CA 726 764 1.01e-10 SMART
EGF_like 884 932 6.81e1 SMART
transmembrane domain 949 971 N/A INTRINSIC
PDB:4HDQ|C 1057 1082 1e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154863
Predicted Effect probably benign
Transcript: ENSMUST00000232568
AA Change: T916A

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired integrity of the heart, blood vessels and lymphatic vessels, resulting in hemopericardium, lung hemorrhage, lymphangiectasis, and chylous ascites, as well as embryonic and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Gene trapped(3)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik T C 11: 76,000,251 S64P possibly damaging Het
4933436I01Rik T A X: 67,920,702 I184L probably benign Het
Abcb5 A T 12: 118,940,568 C162* probably null Het
Akr1c19 A T 13: 4,238,392 probably null Het
Akt3 A G 1: 177,102,985 S136P possibly damaging Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bsn T G 9: 108,110,684 probably benign Het
Bsn T A 9: 108,126,550 M219L possibly damaging Het
Btnl9 T C 11: 49,169,563 T453A probably damaging Het
C6 G T 15: 4,791,070 C521F probably damaging Het
Ccnt1 A T 15: 98,551,942 H156Q probably benign Het
Cdh7 A T 1: 110,137,936 R647* probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Cmya5 T A 13: 93,090,524 K2685N possibly damaging Het
Cnksr2 A C X: 157,945,306 S224R possibly damaging Het
Cntn1 T C 15: 92,318,062 V992A possibly damaging Het
Dapk1 G A 13: 60,751,208 D831N probably damaging Het
Dnaaf3 T C 7: 4,523,799 I426M possibly damaging Het
Dnah6 A G 6: 73,021,182 Y4034H probably benign Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Endov T C 11: 119,499,582 F12S probably damaging Het
Eps8 A T 6: 137,522,174 W239R probably benign Het
Fance T C 17: 28,320,825 F83S possibly damaging Het
Fn1 A G 1: 71,600,439 V1731A probably damaging Het
Gak G T 5: 108,570,225 T1244K probably benign Het
Gas8 T A 8: 123,526,537 I208N probably damaging Het
Gm9830 A T 9: 44,464,282 noncoding transcript Het
Gm9837 T A 11: 53,470,265 probably benign Het
Gtf2f2 A G 14: 75,917,696 S142P possibly damaging Het
Hdac3 C A 18: 37,943,516 G257V probably damaging Het
Herc2 G T 7: 56,132,497 G1311C probably damaging Het
Htt C T 5: 34,825,982 T975I probably benign Het
Il2rg A G X: 101,267,810 L57P possibly damaging Het
Itm2b T C 14: 73,363,135 K242E probably damaging Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Klrg2 G A 6: 38,636,993 T25I probably benign Het
Lcn5 G A 2: 25,658,041 V21M probably damaging Het
Lonp2 A G 8: 86,665,775 T490A probably damaging Het
Lrrn3 A T 12: 41,452,996 S441T probably damaging Het
Mpdz G A 4: 81,335,830 R1W probably null Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mpzl2 G A 9: 45,043,871 probably null Het
Naf1 A G 8: 66,887,780 D414G probably damaging Het
Notch3 A G 17: 32,135,508 C1748R probably benign Het
Nup133 C A 8: 123,914,575 D869Y probably damaging Het
Oasl2 A C 5: 114,911,237 D466A probably benign Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr487 T C 7: 108,212,340 Y63C probably damaging Het
Olfr705 T A 7: 106,714,166 R172W probably benign Het
Olfr709-ps1 T G 7: 106,926,955 Y168S probably damaging Het
Olfr970 T C 9: 39,820,550 F304L probably benign Het
Opa3 T C 7: 19,244,814 I68T possibly damaging Het
Pcdh8 A T 14: 79,768,211 S912R probably damaging Het
Pdzrn3 T C 6: 101,150,699 E1002G probably damaging Het
Pik3c2a A T 7: 116,372,891 L768* probably null Het
Plxna4 A G 6: 32,517,616 S22P possibly damaging Het
Plxnb3 T A X: 73,771,751 Y1845* probably null Het
Pramef6 T C 4: 143,896,912 M231V probably damaging Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Pum1 A G 4: 130,774,434 T845A probably benign Het
Rad21l T C 2: 151,668,007 H58R probably damaging Het
Rgma A C 7: 73,409,631 D161A probably damaging Het
Scai T C 2: 39,123,013 Y135C probably damaging Het
Scn2a T A 2: 65,752,073 H1588Q probably benign Het
Sdha A T 13: 74,323,968 probably null Het
Slc12a3 A G 8: 94,345,828 D658G probably damaging Het
Slc5a3 A G 16: 92,077,240 S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,760,871 probably benign Het
Sulf1 A G 1: 12,840,403 I649V probably damaging Het
Thbs1 C T 2: 118,123,537 Q1090* probably null Het
Tjp2 C A 19: 24,122,323 R400L probably benign Het
Tle4 A T 19: 14,449,749 Y769* probably null Het
Trmt5 A T 12: 73,284,670 probably null Het
Troap T C 15: 99,082,463 L508P probably benign Het
Ubac2 T A 14: 121,908,279 Y116* probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Ush1c T C 7: 46,229,481 Y74C probably damaging Het
Usp36 T C 11: 118,275,018 T160A possibly damaging Het
Usp54 G T 14: 20,577,205 P462T probably damaging Het
Vmn1r55 A G 7: 5,147,049 V125A possibly damaging Het
Vps11 A G 9: 44,358,316 S213P probably damaging Het
Zfp668 C T 7: 127,866,665 G449D probably benign Het
Other mutations in Heg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Heg1 APN 16 33710607 missense probably damaging 0.98
IGL01133:Heg1 APN 16 33727287 missense probably benign 0.01
IGL01410:Heg1 APN 16 33725566 missense possibly damaging 0.95
IGL01561:Heg1 APN 16 33766668 missense probably benign 0.27
IGL02449:Heg1 APN 16 33738725 critical splice donor site probably null
IGL02523:Heg1 APN 16 33738622 missense probably damaging 1.00
IGL02794:Heg1 APN 16 33726622 missense probably damaging 0.99
IGL03240:Heg1 APN 16 33727413 missense probably benign 0.02
I2289:Heg1 UTSW 16 33763459 missense probably damaging 1.00
R0089:Heg1 UTSW 16 33763615 missense probably damaging 1.00
R0116:Heg1 UTSW 16 33735658 splice site probably benign
R0514:Heg1 UTSW 16 33726756 missense possibly damaging 0.86
R0589:Heg1 UTSW 16 33731707 missense probably damaging 1.00
R0942:Heg1 UTSW 16 33760803 missense probably damaging 1.00
R1084:Heg1 UTSW 16 33706997 missense probably benign 0.26
R1109:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R1375:Heg1 UTSW 16 33726876 missense possibly damaging 0.75
R1375:Heg1 UTSW 16 33727309 missense possibly damaging 0.60
R1550:Heg1 UTSW 16 33735553 missense probably damaging 1.00
R1720:Heg1 UTSW 16 33707179 missense probably benign 0.44
R1739:Heg1 UTSW 16 33738583 missense possibly damaging 0.94
R2397:Heg1 UTSW 16 33742479 missense probably damaging 0.99
R4353:Heg1 UTSW 16 33710477 missense probably benign 0.41
R4419:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4420:Heg1 UTSW 16 33727435 missense probably benign 0.23
R4779:Heg1 UTSW 16 33719772 missense probably benign 0.41
R5066:Heg1 UTSW 16 33738671 missense probably benign 0.41
R5227:Heg1 UTSW 16 33763591 missense probably damaging 1.00
R5494:Heg1 UTSW 16 33725434 missense probably benign 0.44
R5645:Heg1 UTSW 16 33706963 missense probably benign
R5708:Heg1 UTSW 16 33742404 missense probably damaging 0.99
R5934:Heg1 UTSW 16 33726919 missense probably damaging 1.00
R6074:Heg1 UTSW 16 33727203 missense possibly damaging 0.49
R6374:Heg1 UTSW 16 33727129 missense possibly damaging 0.86
R6398:Heg1 UTSW 16 33766775 missense probably damaging 0.99
R6774:Heg1 UTSW 16 33738268 missense probably damaging 1.00
R6843:Heg1 UTSW 16 33719526 missense probably benign 0.41
R7091:Heg1 UTSW 16 33726720 missense probably benign 0.01
R7183:Heg1 UTSW 16 33738550 splice site probably null
R7186:Heg1 UTSW 16 33731664 missense probably damaging 1.00
R7294:Heg1 UTSW 16 33726489 missense probably damaging 0.99
R7304:Heg1 UTSW 16 33760790 missense possibly damaging 0.52
R7405:Heg1 UTSW 16 33763449 missense possibly damaging 0.66
X0066:Heg1 UTSW 16 33727416 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TACGGATCCTACCACTCAGC -3'
(R):5'- GAGACAATTAGGCCCATACTGC -3'

Sequencing Primer
(F):5'- TTCAACCACGTCAGCAGGAG -3'
(R):5'- GGCCCATACTGCCCATATTTCATG -3'
Posted On2014-09-17