Incidental Mutation 'R4354:Nudt9'
ID327448
Institutional Source Beutler Lab
Gene Symbol Nudt9
Ensembl Gene ENSMUSG00000029310
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 9
Synonyms1190002C07Rik
MMRRC Submission 041107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R4354 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104046306-104065379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104058111 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 129 (K129E)
Ref Sequence ENSEMBL: ENSMUSP00000117181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031250] [ENSMUST00000128511] [ENSMUST00000134313] [ENSMUST00000148261] [ENSMUST00000150226]
Predicted Effect probably damaging
Transcript: ENSMUST00000031250
AA Change: K179E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031250
Gene: ENSMUSG00000029310
AA Change: K179E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
Pfam:NUDIX 189 334 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128511
AA Change: K129E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119820
Gene: ENSMUSG00000029310
AA Change: K129E

DomainStartEndE-ValueType
PDB:1QVJ|A 9 158 1e-89 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000134313
AA Change: K129E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117181
Gene: ENSMUSG00000029310
AA Change: K129E

DomainStartEndE-ValueType
PDB:1QVJ|A 9 152 2e-84 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142018
Predicted Effect probably benign
Transcript: ENSMUST00000148261
SMART Domains Protein: ENSMUSP00000115170
Gene: ENSMUSG00000029310

DomainStartEndE-ValueType
PDB:1QVJ|A 9 110 2e-68 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000150226
AA Change: K129E

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114631
Gene: ENSMUSG00000029310
AA Change: K129E

DomainStartEndE-ValueType
low complexity region 102 116 N/A INTRINSIC
Pfam:NUDIX 131 207 6.4e-9 PFAM
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Nudix hydrolase family. Nudix boxes are found in a family of diverse enzymes that catalyze the hydrolysis of nucleoside diphosphate derivatives. This enzyme is an ADP-ribose pyrophosphatase that catalyzes the hydrolysis of ADP-ribose to AMP and ribose-5-P. It requires divalent metal ions and an intact Nudix motif for enzymatic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Abca8b A C 11: 109,971,692 S416A probably benign Het
Abcb4 A T 5: 8,918,771 N370I probably benign Het
Abi3bp T C 16: 56,532,951 F81S probably benign Het
Ablim1 C T 19: 57,155,278 C83Y probably damaging Het
Adamtsl1 A T 4: 86,156,684 H96L probably damaging Het
Alms1-ps1 C T 6: 85,755,635 noncoding transcript Het
AU040320 A G 4: 126,854,399 probably benign Het
Chd1 T A 17: 17,390,001 H472Q probably benign Het
Chgb A T 2: 132,793,944 D602V probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Gpa33 A G 1: 166,163,835 T212A possibly damaging Het
Hspg2 C A 4: 137,468,911 A17E probably benign Het
Irf7 T C 7: 141,265,270 R8G probably damaging Het
Kcnv1 G A 15: 45,114,444 T66M probably damaging Het
Loxhd1 T C 18: 77,395,427 Y1235H probably damaging Het
Mon2 T C 10: 123,026,983 T680A probably benign Het
Nab1 A T 1: 52,490,696 L14Q probably damaging Het
Neu4 C T 1: 94,024,557 T216I probably damaging Het
Nle1 A G 11: 82,906,431 C152R possibly damaging Het
Nprl3 T A 11: 32,234,906 M368L probably benign Het
Olfr368 T C 2: 37,331,876 L43P probably damaging Het
Pdzd8 T C 19: 59,345,481 D36G probably benign Het
Pga5 C T 19: 10,674,826 probably null Het
Pold3 T C 7: 100,100,617 K47E possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,915,641 I251V probably benign Het
Susd2 G T 10: 75,639,728 F447L probably damaging Het
Tbc1d7 T C 13: 43,169,868 K16E probably damaging Het
Tlr8 T G X: 167,242,872 Q994P probably damaging Het
Ube2j1 T C 4: 33,049,682 Y227H probably benign Het
Other mutations in Nudt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Nudt9 APN 5 104061762 unclassified probably benign
IGL01398:Nudt9 APN 5 104065113 makesense probably null
IGL01910:Nudt9 APN 5 104054309 missense probably damaging 0.96
IGL02441:Nudt9 APN 5 104065019 missense probably benign 0.01
IGL03207:Nudt9 APN 5 104058226 splice site probably benign
steady UTSW 5 104058111 missense probably damaging 1.00
streak UTSW 5 104050621 start codon destroyed possibly damaging 0.89
struck UTSW 5 104065038 nonsense probably null
R0136:Nudt9 UTSW 5 104047106 missense probably benign
R0227:Nudt9 UTSW 5 104061675 missense possibly damaging 0.90
R0652:Nudt9 UTSW 5 104050601 missense possibly damaging 0.48
R0755:Nudt9 UTSW 5 104065054 missense probably damaging 0.98
R1156:Nudt9 UTSW 5 104050730 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1462:Nudt9 UTSW 5 104065038 nonsense probably null
R1962:Nudt9 UTSW 5 104065105 missense probably benign
R2697:Nudt9 UTSW 5 104064993 missense probably damaging 1.00
R2916:Nudt9 UTSW 5 104055558 missense probably damaging 1.00
R3780:Nudt9 UTSW 5 104047106 missense probably benign
R3972:Nudt9 UTSW 5 104047125 missense probably benign 0.00
R5325:Nudt9 UTSW 5 104050621 start codon destroyed possibly damaging 0.89
R5652:Nudt9 UTSW 5 104059780 missense probably benign 0.19
R6087:Nudt9 UTSW 5 104050813 missense probably benign 0.00
R6240:Nudt9 UTSW 5 104047089 missense probably benign 0.31
R6241:Nudt9 UTSW 5 104054285 missense probably damaging 0.98
R6280:Nudt9 UTSW 5 104065069 missense probably benign
R6719:Nudt9 UTSW 5 104061696 missense probably damaging 1.00
R6865:Nudt9 UTSW 5 104059679 missense probably damaging 1.00
R7225:Nudt9 UTSW 5 104065100 missense probably benign
X0063:Nudt9 UTSW 5 104050694 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATACAGCACCCTTGTGTG -3'
(R):5'- ACCGTCTATCATCCTAAGCTTG -3'

Sequencing Primer
(F):5'- GAACTAAACTTCCTTAACTGGGGTG -3'
(R):5'- TGGTGACAAAGATCAGTCTCCTG -3'
Posted On2015-07-07