Incidental Mutation 'R4464:Rad51ap1'
ID330270
Institutional Source Beutler Lab
Gene Symbol Rad51ap1
Ensembl Gene ENSMUSG00000030346
Gene NameRAD51 associated protein 1
SynonymsRAB22, 2510006L10Rik
MMRRC Submission 041722-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R4464 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126923050-126939587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126934768 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 52 (N52S)
Ref Sequence ENSEMBL: ENSMUSP00000144327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112220] [ENSMUST00000112221] [ENSMUST00000144954] [ENSMUST00000202897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112220
AA Change: N52S

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107839
Gene: ENSMUSG00000030346
AA Change: N52S

DomainStartEndE-ValueType
low complexity region 179 204 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112221
AA Change: N52S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107841
Gene: ENSMUSG00000030346
AA Change: N52S

DomainStartEndE-ValueType
low complexity region 180 205 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
Pfam:RAD51_interact 293 331 1.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141212
Predicted Effect possibly damaging
Transcript: ENSMUST00000144954
AA Change: N52S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122978
Gene: ENSMUSG00000030346
AA Change: N52S

DomainStartEndE-ValueType
low complexity region 121 146 N/A INTRINSIC
low complexity region 153 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202835
Predicted Effect possibly damaging
Transcript: ENSMUST00000202897
AA Change: N52S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 63,898,839 probably benign Het
Abcc3 A G 11: 94,358,786 V1111A probably benign Het
Acot10 G A 15: 20,665,744 R304* probably null Het
Aldh8a1 C A 10: 21,388,941 probably benign Het
Alms1 A G 6: 85,620,021 T1079A possibly damaging Het
Armc3 T C 2: 19,248,659 Y204H probably damaging Het
Asnsd1 C A 1: 53,352,527 probably null Het
Atad5 T A 11: 80,100,311 probably null Het
Cst12 G A 2: 148,789,517 V53I possibly damaging Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Dennd1a A T 2: 38,243,390 probably benign Het
Fam213a T A 14: 40,997,875 K127N probably damaging Het
Gm7535 C A 17: 17,911,662 probably benign Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Ifngr1 G A 10: 19,597,517 V72I possibly damaging Het
Kifap3 C A 1: 163,817,895 Q269K probably benign Het
Krt86 G A 15: 101,473,914 D122N probably damaging Het
Lrrcc1 A G 3: 14,557,318 K694E probably damaging Het
Mbd4 A G 6: 115,849,502 L155S probably damaging Het
Nalcn T C 14: 123,323,350 N772D probably benign Het
Olfr109 C T 17: 37,466,851 S215F probably damaging Het
Psg29 A T 7: 17,210,650 N362Y possibly damaging Het
Ptpn23 G A 9: 110,386,813 T1325I probably damaging Het
Rb1 C A 14: 73,199,198 probably null Het
Slc34a2 T C 5: 53,069,182 L490P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
St3gal2 A G 8: 110,967,502 N207D probably benign Het
Stat1 T G 1: 52,137,416 D257E possibly damaging Het
Tkt A G 14: 30,568,274 T165A possibly damaging Het
Trim66 A T 7: 109,477,690 S347R possibly damaging Het
Zfp429 T C 13: 67,390,498 I276V probably benign Het
Other mutations in Rad51ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Rad51ap1 APN 6 126928160 missense probably damaging 1.00
IGL02371:Rad51ap1 APN 6 126927564 missense probably benign 0.14
IGL02398:Rad51ap1 APN 6 126928151 missense probably damaging 1.00
R0265:Rad51ap1 UTSW 6 126924197 makesense probably null
R0359:Rad51ap1 UTSW 6 126934741 missense probably damaging 1.00
R0488:Rad51ap1 UTSW 6 126934760 missense possibly damaging 0.94
R1527:Rad51ap1 UTSW 6 126928167 splice site probably null
R3018:Rad51ap1 UTSW 6 126939522 start gained probably null
R4691:Rad51ap1 UTSW 6 126927553 missense probably benign
R5314:Rad51ap1 UTSW 6 126928158 missense probably damaging 1.00
R5469:Rad51ap1 UTSW 6 126928227 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAAGCACTTGATGGCACCTC -3'
(R):5'- ACCAGTGTTCATCATCAGTGAG -3'

Sequencing Primer
(F):5'- TTGATGGCACCTCCCCGTG -3'
(R):5'- GTGTTCATCATCAGTGAGACAAATTG -3'
Posted On2015-07-21