Incidental Mutation 'R4549:Ankrd60'
ID333887
Institutional Source Beutler Lab
Gene Symbol Ankrd60
Ensembl Gene ENSMUSG00000027517
Gene Nameankyrin repeat domain 60
Synonyms1700019A24Rik, 1700030G11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4549 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location173568666-173578365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173572602 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 125 (T125S)
Ref Sequence ENSEMBL: ENSMUSP00000113291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109112] [ENSMUST00000119453]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109112
AA Change: T5S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104740
Gene: ENSMUSG00000027517
AA Change: T5S

DomainStartEndE-ValueType
ANK 73 102 2.83e0 SMART
ANK 106 135 2.13e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119453
AA Change: T125S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113291
Gene: ENSMUSG00000027517
AA Change: T125S

DomainStartEndE-ValueType
low complexity region 1 21 N/A INTRINSIC
Blast:UBQ 70 142 5e-39 BLAST
ANK 193 222 2.83e0 SMART
ANK 226 255 2.13e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147693
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adpgk G A 9: 59,310,228 V175I probably damaging Het
Aldh7a1 A G 18: 56,531,994 V371A probably benign Het
Ap1m1 T A 8: 72,240,220 Y7N probably damaging Het
Carmil3 G A 14: 55,505,664 probably null Het
Fsip2 T A 2: 82,989,628 L5235H probably damaging Het
Galnt17 A G 5: 131,150,937 L124P probably damaging Het
Gnpda2 T A 5: 69,586,529 E54D probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Ly6f T A 15: 75,271,730 N95K probably benign Het
Macf1 T C 4: 123,473,693 D2425G possibly damaging Het
Prkdc G A 16: 15,736,870 E2152K possibly damaging Het
Serpinb6e T A 13: 33,833,231 T269S possibly damaging Het
Smg1 A G 7: 118,159,683 probably benign Het
Snapc1 C A 12: 73,970,279 D9E probably damaging Het
Syt8 G T 7: 142,439,462 V35L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trappc10 T C 10: 78,231,458 R49G probably damaging Het
Vmn1r81 A T 7: 12,259,822 F286L probably damaging Het
Vwa5a A T 9: 38,737,925 K656N probably benign Het
Zfp438 A G 18: 5,214,073 V295A probably benign Het
Other mutations in Ankrd60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01980:Ankrd60 APN 2 173571203 missense probably benign 0.33
R0060:Ankrd60 UTSW 2 173572613 start codon destroyed probably null 1.00
R0060:Ankrd60 UTSW 2 173572613 start codon destroyed probably null 1.00
R0569:Ankrd60 UTSW 2 173571066 missense probably damaging 1.00
R0587:Ankrd60 UTSW 2 173568851 missense possibly damaging 0.83
R2941:Ankrd60 UTSW 2 173568881 missense probably damaging 1.00
R5322:Ankrd60 UTSW 2 173568817 missense possibly damaging 0.76
R5763:Ankrd60 UTSW 2 173578089 frame shift probably null
R5786:Ankrd60 UTSW 2 173578089 frame shift probably null
R5787:Ankrd60 UTSW 2 173578089 frame shift probably null
R5788:Ankrd60 UTSW 2 173578089 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCATGCAGAAAGCTCTTCTTC -3'
(R):5'- ACCATCAAGGGAGAGACTTCC -3'

Sequencing Primer
(F):5'- AGTTTCACACTAAAGACTAAAGACTG -3'
(R):5'- AGGGAGAGACTTCCCCCAC -3'
Posted On2015-08-18