Mutagenetix > Incidental Mutations

Incidental Mutation 'R4549:Ankrd60'

333887

Institutional Source

Beutler Lab

Gene Symbol

Ankrd60

Ensembl Gene

ENSMUSG00000027517

Gene Name

ankyrin repeat domain 60

Synonyms

1700019A24Rik, 1700030G11Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4549 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

173568666-173578365 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 173572602 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 125 (T125S)

Ref Sequence

ENSEMBL: ENSMUSP00000113291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109112] [ENSMUST00000119453]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109112
AA Change: T5S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000104740
Gene: ENSMUSG00000027517
AA Change: T5S

Domain	Start	End	E-Value	Type
ANK	73	102	2.83e0	SMART
ANK	106	135	2.13e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119453
AA Change: T125S

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113291
Gene: ENSMUSG00000027517
AA Change: T125S

Domain	Start	End	E-Value	Type
low complexity region	1	21	N/A	INTRINSIC
Blast:UBQ	70	142	5e-39	BLAST
ANK	193	222	2.83e0	SMART
ANK	226	255	2.13e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147693

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adpgk	G	A	9: 59,310,228	V175I	probably damaging	Het
Aldh7a1	A	G	18: 56,531,994	V371A	probably benign	Het
Ap1m1	T	A	8: 72,240,220	Y7N	probably damaging	Het
Carmil3	G	A	14: 55,505,664		probably null	Het
Fsip2	T	A	2: 82,989,628	L5235H	probably damaging	Het
Galnt17	A	G	5: 131,150,937	L124P	probably damaging	Het
Gnpda2	T	A	5: 69,586,529	E54D	probably benign	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Ly6f	T	A	15: 75,271,730	N95K	probably benign	Het
Macf1	T	C	4: 123,473,693	D2425G	possibly damaging	Het
Prkdc	G	A	16: 15,736,870	E2152K	possibly damaging	Het
Serpinb6e	T	A	13: 33,833,231	T269S	possibly damaging	Het
Smg1	A	G	7: 118,159,683		probably benign	Het
Snapc1	C	A	12: 73,970,279	D9E	probably damaging	Het
Syt8	G	T	7: 142,439,462	V35L	probably benign	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Trappc10	T	C	10: 78,231,458	R49G	probably damaging	Het
Vmn1r81	A	T	7: 12,259,822	F286L	probably damaging	Het
Vwa5a	A	T	9: 38,737,925	K656N	probably benign	Het
Zfp438	A	G	18: 5,214,073	V295A	probably benign	Het

Other mutations in Ankrd60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01980:Ankrd60	APN	2	173571203	missense	probably benign	0.33
R0060:Ankrd60	UTSW	2	173572613	start codon destroyed	probably null	1.00
R0060:Ankrd60	UTSW	2	173572613	start codon destroyed	probably null	1.00
R0569:Ankrd60	UTSW	2	173571066	missense	probably damaging	1.00
R0587:Ankrd60	UTSW	2	173568851	missense	possibly damaging	0.83
R2941:Ankrd60	UTSW	2	173568881	missense	probably damaging	1.00
R5322:Ankrd60	UTSW	2	173568817	missense	possibly damaging	0.76
R5763:Ankrd60	UTSW	2	173578089	frame shift	probably null
R5786:Ankrd60	UTSW	2	173578089	frame shift	probably null
R5787:Ankrd60	UTSW	2	173578089	frame shift	probably null
R5788:Ankrd60	UTSW	2	173578089	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCCATGCAGAAAGCTCTTCTTC -3'
(R):5'- ACCATCAAGGGAGAGACTTCC -3'

Sequencing Primer
(F):5'- AGTTTCACACTAAAGACTAAAGACTG -3'
(R):5'- AGGGAGAGACTTCCCCCAC -3'

Posted On

2015-08-18