Incidental Mutation 'R4577:Gm13178'
ID342536
Institutional Source Beutler Lab
Gene Symbol Gm13178
Ensembl Gene ENSMUSG00000041735
Gene Namepredicted gene 13178
Synonyms
Accession Numbers

Ncbi RefSeq: NM_001085536.1; MGI: 3650721

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4577 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location144703191-144721404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 144703753 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 222 (I222S)
Ref Sequence ENSEMBL: ENSMUSP00000045343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036876]
Predicted Effect probably damaging
Transcript: ENSMUST00000036876
AA Change: I222S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045343
Gene: ENSMUSG00000041735
AA Change: I222S

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 43 60 N/A INTRINSIC
low complexity region 79 84 N/A INTRINSIC
Pfam:Abhydrolase_3 116 286 2.3e-27 PFAM
Pfam:Abhydrolase_3 287 382 8.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209924
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A G 7: 139,978,130 I51T probably damaging Het
Abca1 C A 4: 53,062,568 C1429F possibly damaging Het
Acacb A G 5: 114,226,831 E1524G probably damaging Het
Ankrd50 A G 3: 38,455,941 V759A probably damaging Het
Ano9 T C 7: 141,104,138 Q538R probably damaging Het
Bnip2 A G 9: 69,997,162 D67G probably benign Het
Cacna1e A T 1: 154,402,027 S2060T possibly damaging Het
Cand2 G A 6: 115,791,259 C455Y probably damaging Het
Cdh16 T C 8: 104,618,559 D366G probably damaging Het
Cep170b A G 12: 112,744,718 R595G probably damaging Het
Chaf1a G A 17: 56,065,184 R784Q probably damaging Het
Clca4a C A 3: 144,954,969 S698I probably damaging Het
Dnah5 A C 15: 28,289,250 Y1195S probably benign Het
Dysf T C 6: 84,137,326 I1229T probably damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Ep300 T C 15: 81,649,009 S1756P unknown Het
Ep300 T A 15: 81,611,410 probably benign Het
F3 A G 3: 121,734,114 I254V probably benign Het
Fam166a T C 2: 25,220,288 S71P probably benign Het
Frmd4a C A 2: 4,603,679 A786E possibly damaging Het
Fsd1l T C 4: 53,686,397 F270S probably damaging Het
Galnt3 T C 2: 66,097,859 Y231C probably benign Het
Gm10220 A C 5: 26,117,871 I181S probably benign Het
Gnb5 G A 9: 75,343,541 V316I possibly damaging Het
Gys2 A G 6: 142,454,510 F325S possibly damaging Het
Hmgn2 G A 4: 133,967,357 probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Iqub A T 6: 24,501,291 I220N probably damaging Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Kcnq3 T C 15: 66,286,214 K4R unknown Het
Klk12 A G 7: 43,773,243 D198G probably damaging Het
L3mbtl2 G A 15: 81,686,285 E655K probably benign Het
Lrp1b C T 2: 40,821,719 C3163Y probably damaging Het
Map3k19 T A 1: 127,822,813 R934* probably null Het
Map4 A G 9: 110,081,421 T1061A possibly damaging Het
Mbnl1 G A 3: 60,529,778 V50I probably damaging Het
Med15 G A 16: 17,674,515 Q132* probably null Het
Mef2a T C 7: 67,240,439 N131S probably benign Het
Mtmr3 G C 11: 4,497,375 L361V probably damaging Het
Myo5a A G 9: 75,217,545 E1792G probably damaging Het
Nup88 C A 11: 70,969,717 A55S probably damaging Het
Olfr1252 T C 2: 89,722,043 K23E possibly damaging Het
Olfr374 T A 8: 72,110,323 Y252* probably null Het
Pacs1 G T 19: 5,143,833 S556* probably null Het
Parp4 A G 14: 56,590,410 E206G probably benign Het
Paxbp1 T G 16: 91,015,154 K889N probably damaging Het
Pcdhga2 G A 18: 37,669,249 A49T possibly damaging Het
Pcsk6 T A 7: 65,959,266 L292* probably null Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Plec C A 15: 76,184,069 Q1142H possibly damaging Het
Pnpla2 T C 7: 141,457,344 S87P probably damaging Het
Prss28 T C 17: 25,310,105 V140A probably damaging Het
Rad17 A T 13: 100,633,278 S258T probably damaging Het
Rnf111 A T 9: 70,429,584 C932* probably null Het
Sdc2 T C 15: 33,017,132 Y31H probably damaging Het
Selenoh T C 2: 84,670,331 E55G possibly damaging Het
Serpina3k T G 12: 104,344,192 V327G possibly damaging Het
Setd1b A G 5: 123,148,616 E575G unknown Het
Slco1a4 A T 6: 141,819,540 S325R probably damaging Het
Smtnl1 C A 2: 84,818,443 V156L possibly damaging Het
Speg A G 1: 75,415,395 D1607G probably damaging Het
Tctex1d4 A G 4: 117,128,615 T212A possibly damaging Het
Tmem101 T A 11: 102,155,837 M69L possibly damaging Het
Treh G A 9: 44,685,911 M542I probably benign Het
Trim30b T C 7: 104,357,331 Y106C possibly damaging Het
Ttc6 T C 12: 57,576,655 I280T probably benign Het
Ubtfl1 A G 9: 18,409,493 T106A probably damaging Het
Wdr27 T C 17: 14,903,462 H583R probably benign Het
Xirp2 C T 2: 67,513,897 P2161S probably damaging Het
Other mutations in Gm13178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Gm13178 APN 4 144703693 missense possibly damaging 0.87
IGL01985:Gm13178 APN 4 144715454 nonsense probably null
IGL02587:Gm13178 APN 4 144703399 missense possibly damaging 0.94
P0018:Gm13178 UTSW 4 144703197 missense probably benign 0.00
R0395:Gm13178 UTSW 4 144703195 missense probably benign 0.14
R1617:Gm13178 UTSW 4 144715391 missense probably damaging 1.00
R3802:Gm13178 UTSW 4 144703504 missense possibly damaging 0.82
R4409:Gm13178 UTSW 4 144721302 missense possibly damaging 0.86
R4603:Gm13178 UTSW 4 144703228 missense probably benign 0.00
R5069:Gm13178 UTSW 4 144703867 missense probably damaging 1.00
R5801:Gm13178 UTSW 4 144703636 missense probably damaging 1.00
R5802:Gm13178 UTSW 4 144703636 missense probably damaging 1.00
R5893:Gm13178 UTSW 4 144703196 missense probably benign
R6148:Gm13178 UTSW 4 144721317 missense possibly damaging 0.89
R6466:Gm13178 UTSW 4 144703867 missense probably damaging 1.00
R6655:Gm13178 UTSW 4 144705245 missense probably damaging 1.00
R7006:Gm13178 UTSW 4 144721283 missense probably benign 0.00
R7021:Gm13178 UTSW 4 144715492 missense probably damaging 1.00
R7030:Gm13178 UTSW 4 144703603 missense possibly damaging 0.85
R7514:Gm13178 UTSW 4 144703228 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGGAATATTGTCAGAGCTGAG -3'
(R):5'- TAGGTACCGCAAGCTTCCTG -3'

Sequencing Primer
(F):5'- GAATATTGTCAGAGCTGAGCCACTTG -3'
(R):5'- ATCATCCTGTTGTTTACCTGGATTG -3'
Posted On2015-09-24