Incidental Mutation 'R6655:Gm13178'
ID526584
Institutional Source Beutler Lab
Gene Symbol Gm13178
Ensembl Gene ENSMUSG00000041735
Gene Namepredicted gene 13178
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001085536.1; MGI: 3650721

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6655 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144703191-144721404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144705245 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 130 (D130V)
Ref Sequence ENSEMBL: ENSMUSP00000045343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036876]
Predicted Effect probably damaging
Transcript: ENSMUST00000036876
AA Change: D130V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045343
Gene: ENSMUSG00000041735
AA Change: D130V

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
transmembrane domain 43 60 N/A INTRINSIC
low complexity region 79 84 N/A INTRINSIC
Pfam:Abhydrolase_3 116 286 2.3e-27 PFAM
Pfam:Abhydrolase_3 287 382 8.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209924
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A G 7: 127,384,340 L530P possibly damaging Het
Akr1b3 C T 6: 34,310,004 V206M possibly damaging Het
Alg3 T A 16: 20,609,026 Y12F probably benign Het
Arhgef28 A G 13: 97,899,655 Y1699H probably damaging Het
Cd109 A G 9: 78,684,938 D778G probably benign Het
Dlc1 A G 8: 36,572,716 V1430A probably damaging Het
Dscaml1 G A 9: 45,746,937 V1669I probably benign Het
Fkbp8 A G 8: 70,532,670 Y278C probably damaging Het
Gm5160 T C 18: 14,425,130 F88S possibly damaging Het
Kcnh1 A G 1: 192,413,083 N483S possibly damaging Het
Lrp2 A G 2: 69,453,858 S3859P probably benign Het
Myof T C 19: 37,934,791 N1351S probably damaging Het
Nbn A G 4: 15,981,696 E596G probably damaging Het
Neurl4 T C 11: 69,910,916 probably null Het
Nol8 T C 13: 49,654,392 L10P probably damaging Het
Olfr325 T A 11: 58,581,210 M122K probably damaging Het
Olfr806 T C 10: 129,738,087 T277A possibly damaging Het
Pex26 T C 6: 121,190,211 probably benign Het
Rab3gap2 T C 1: 185,250,011 M420T probably damaging Het
Samd9l C A 6: 3,377,247 V5L probably benign Het
Sec22b T A 3: 97,914,648 probably null Het
Shank1 A G 7: 44,327,220 I581V unknown Het
Ssbp2 C T 13: 91,664,149 P105L probably damaging Het
Ttll9 T C 2: 153,000,303 probably null Het
Veph1 T A 3: 66,205,613 I257F possibly damaging Het
Vmn1r222 A C 13: 23,232,716 I109S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wnt16 T C 6: 22,290,966 V131A probably damaging Het
Other mutations in Gm13178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Gm13178 APN 4 144703693 missense possibly damaging 0.87
IGL01985:Gm13178 APN 4 144715454 nonsense probably null
IGL02587:Gm13178 APN 4 144703399 missense possibly damaging 0.94
P0018:Gm13178 UTSW 4 144703197 missense probably benign 0.00
R0395:Gm13178 UTSW 4 144703195 missense probably benign 0.14
R1617:Gm13178 UTSW 4 144715391 missense probably damaging 1.00
R3802:Gm13178 UTSW 4 144703504 missense possibly damaging 0.82
R4409:Gm13178 UTSW 4 144721302 missense possibly damaging 0.86
R4577:Gm13178 UTSW 4 144703753 missense probably damaging 1.00
R4603:Gm13178 UTSW 4 144703228 missense probably benign 0.00
R5069:Gm13178 UTSW 4 144703867 missense probably damaging 1.00
R5801:Gm13178 UTSW 4 144703636 missense probably damaging 1.00
R5802:Gm13178 UTSW 4 144703636 missense probably damaging 1.00
R5893:Gm13178 UTSW 4 144703196 missense probably benign
R6148:Gm13178 UTSW 4 144721317 missense possibly damaging 0.89
R6466:Gm13178 UTSW 4 144703867 missense probably damaging 1.00
R7006:Gm13178 UTSW 4 144721283 missense probably benign 0.00
R7021:Gm13178 UTSW 4 144715492 missense probably damaging 1.00
R7030:Gm13178 UTSW 4 144703603 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGAAGATCTATGCAGGCTTTTGC -3'
(R):5'- GTCATCTTCCCACCCGAAAG -3'

Sequencing Primer
(F):5'- CTATGCAGGCTTTTGCTATTTTTCAG -3'
(R):5'- ACTTAAGAGCTTGTCACTAGCC -3'
Posted On2018-07-23