Incidental Mutation 'R4621:Larp1b'
ID346128
Institutional Source Beutler Lab
Gene Symbol Larp1b
Ensembl Gene ENSMUSG00000025762
Gene NameLa ribonucleoprotein domain family, member 1B
SynonymsLarp2, 1700108L22Rik, 4933421B21Rik
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location40950354-41040234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40963989 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 22 (G22R)
Ref Sequence ENSEMBL: ENSMUSP00000142106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048490] [ENSMUST00000191805] [ENSMUST00000191872] [ENSMUST00000200432]
Predicted Effect probably benign
Transcript: ENSMUST00000048490
AA Change: G22R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037127
Gene: ENSMUSG00000025762
AA Change: G22R

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
low complexity region 138 164 N/A INTRINSIC
LA 213 291 4.35e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191805
AA Change: G22R

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141487
Gene: ENSMUSG00000025762
AA Change: G22R

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
low complexity region 138 164 N/A INTRINSIC
LA 213 291 4.35e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191872
AA Change: G22R

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142106
Gene: ENSMUSG00000025762
AA Change: G22R

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 91 117 N/A INTRINSIC
LA 166 244 4.35e-37 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193795
AA Change: G3R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197092
Predicted Effect probably benign
Transcript: ENSMUST00000200432
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Angptl1 G A 1: 156,844,924 V107M probably damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Larp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Larp1b APN 3 41033440 nonsense probably null
IGL01636:Larp1b APN 3 40970478 missense probably benign 0.35
IGL01845:Larp1b APN 3 40970525 missense probably benign 0.03
IGL02192:Larp1b APN 3 40967494 missense probably benign 0.01
IGL03372:Larp1b APN 3 41024527 missense possibly damaging 0.79
R0396:Larp1b UTSW 3 40970561 missense probably damaging 1.00
R0512:Larp1b UTSW 3 40970034 missense probably benign 0.00
R0975:Larp1b UTSW 3 40970490 missense probably damaging 0.99
R1119:Larp1b UTSW 3 41033528 missense possibly damaging 0.87
R1337:Larp1b UTSW 3 41033402 missense probably damaging 1.00
R1460:Larp1b UTSW 3 40962218 missense probably benign
R1565:Larp1b UTSW 3 40972384 missense probably damaging 1.00
R1589:Larp1b UTSW 3 41033474 missense probably damaging 1.00
R1640:Larp1b UTSW 3 41034072 start codon destroyed probably null 0.04
R1899:Larp1b UTSW 3 40964084 missense probably benign 0.04
R2133:Larp1b UTSW 3 40970535 missense possibly damaging 0.69
R3054:Larp1b UTSW 3 40964100 missense probably benign 0.10
R4818:Larp1b UTSW 3 40970570 missense probably damaging 1.00
R5023:Larp1b UTSW 3 41033985 missense possibly damaging 0.88
R5166:Larp1b UTSW 3 40964052 nonsense probably null
R5357:Larp1b UTSW 3 41024515 missense probably benign 0.04
R5364:Larp1b UTSW 3 40977223 missense probably damaging 0.99
R5492:Larp1b UTSW 3 40969899 missense probably damaging 0.99
R5495:Larp1b UTSW 3 41035822 missense probably damaging 1.00
R7070:Larp1b UTSW 3 40976651 missense probably damaging 1.00
X0021:Larp1b UTSW 3 40967494 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTACTTGACAAGTGCCCCAC -3'
(R):5'- ATCACCATGCAATGCAGTCTTC -3'

Sequencing Primer
(F):5'- ACTCCCCAGGATTTTTACTTTGGG -3'
(R):5'- TTCAAGTTAGAATGAAGACTCAGGCC -3'
Posted On2015-09-25