Incidental Mutation 'R4721:Tmem63c'
ID354485
Institutional Source Beutler Lab
Gene Symbol Tmem63c
Ensembl Gene ENSMUSG00000034145
Gene Nametransmembrane protein 63c
Synonyms9330187M14Rik
MMRRC Submission 041986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4721 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87021340-87090043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87057180 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 68 (A68S)
Ref Sequence ENSEMBL: ENSMUSP00000119872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110187] [ENSMUST00000131878] [ENSMUST00000146292] [ENSMUST00000154801] [ENSMUST00000156162]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110187
AA Change: A68S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105816
Gene: ENSMUSG00000034145
AA Change: A68S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131878
AA Change: A68S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117023
Gene: ENSMUSG00000034145
AA Change: A68S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146292
AA Change: A68S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119872
Gene: ENSMUSG00000034145
AA Change: A68S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 1.6e-20 PFAM
Pfam:PHM7_cyt 253 323 6e-12 PFAM
Pfam:RSN1_7TM 341 680 2.5e-88 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154801
AA Change: A68S

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119898
Gene: ENSMUSG00000034145
AA Change: A68S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 179 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156162
AA Change: A68S

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122346
Gene: ENSMUSG00000034145
AA Change: A68S

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,150 D286G probably benign Het
Abca15 G A 7: 120,350,775 E491K probably benign Het
Acsl5 A G 19: 55,280,530 T208A probably benign Het
Adamts10 T A 17: 33,545,537 probably null Het
Ahcyl1 T C 3: 107,669,917 Q313R possibly damaging Het
Ccdc71 C T 9: 108,463,423 S145L possibly damaging Het
Cep250 A G 2: 155,970,199 T472A probably damaging Het
Copa T C 1: 172,104,274 probably benign Het
Crybg1 C A 10: 43,997,887 R1075L probably damaging Het
Ddr2 T A 1: 170,005,240 K84* probably null Het
Ddx59 C T 1: 136,417,106 P172S probably benign Het
Dhx34 T A 7: 16,197,382 Q1118L possibly damaging Het
Dkkl1 T A 7: 45,207,808 I112F probably damaging Het
Dnah8 T A 17: 30,725,166 C1786S probably damaging Het
Eml6 T A 11: 29,838,525 D520V possibly damaging Het
Ergic1 T A 17: 26,638,776 V192E probably damaging Het
Fat3 T C 9: 16,029,966 E1343G probably damaging Het
Fxr1 T C 3: 34,064,232 S535P possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 C T 5: 109,943,000 H373Y probably damaging Het
Gpr157 A T 4: 150,098,963 N197Y probably benign Het
Grid2 G A 6: 64,666,201 M982I probably benign Het
Hey2 G T 10: 30,834,308 R150S possibly damaging Het
Hmcn1 T C 1: 150,772,571 probably null Het
Ighv3-3 G A 12: 114,196,536 R85* probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Igsf21 A G 4: 140,107,310 S84P probably benign Het
Kif20b A G 19: 34,938,373 T517A probably benign Het
Krt83 T C 15: 101,487,982 E244G probably damaging Het
Lrp1 T C 10: 127,555,059 T2990A possibly damaging Het
Lrp1b T A 2: 40,715,369 probably null Het
Lrrc42 A T 4: 107,233,853 S382T probably benign Het
Magi2 C T 5: 20,534,469 R737W probably damaging Het
Mcc A G 18: 44,519,556 L267P probably damaging Het
Mzf1 T A 7: 13,043,296 Q727L possibly damaging Het
Mzf1 C T 7: 13,043,521 R652Q possibly damaging Het
Nkain3 C T 4: 20,485,015 A21T probably damaging Het
Nlrp4e T A 7: 23,321,096 V336E possibly damaging Het
Nptn C T 9: 58,640,776 R155C probably damaging Het
Nr2c2 T C 6: 92,139,847 I10T possibly damaging Het
Olfr1148 T A 2: 87,833,171 I44N probably damaging Het
Olfr341 T C 2: 36,479,824 Y102C probably benign Het
Olfr385 C T 11: 73,589,447 C97Y probably damaging Het
Pdzk1 G T 3: 96,869,202 E493* probably null Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Polr3b T C 10: 84,656,003 V342A possibly damaging Het
Prg3 T C 2: 84,991,406 V125A possibly damaging Het
Raph1 G A 1: 60,503,001 probably benign Het
Rassf2 A G 2: 132,004,438 V133A probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rbpjl A C 2: 164,404,527 S31R probably benign Het
Reln A G 5: 21,919,222 V2762A probably damaging Het
Rxrg T A 1: 167,625,052 I141N probably damaging Het
Scn7a C A 2: 66,684,185 G1082C probably damaging Het
Selenon C A 4: 134,543,076 E322* probably null Het
Sipa1 C T 19: 5,660,385 R199Q probably damaging Het
Slc26a7 A T 4: 14,510,261 probably null Het
Slc37a4 T C 9: 44,401,490 S314P possibly damaging Het
Smarce1 T C 11: 99,220,717 I59V probably benign Het
Stk19 T C 17: 34,823,144 probably null Het
Susd2 C T 10: 75,638,130 D544N probably benign Het
Tcf7l2 G T 19: 55,931,454 R465L possibly damaging Het
Tfap2d T A 1: 19,104,760 S146T possibly damaging Het
Tmem156 A G 5: 65,091,527 F10S probably benign Het
Tnfrsf21 T C 17: 43,085,504 C560R probably damaging Het
Trav10n C T 14: 53,122,133 T7I probably benign Het
Ttc38 C T 15: 85,838,746 R132W probably benign Het
Tvp23a T C 16: 10,427,411 K108R probably benign Het
Vmn1r233 T C 17: 20,994,617 M24V probably benign Het
Vmn1r88 T A 7: 13,178,524 L269* probably null Het
Vmn2r101 T A 17: 19,612,025 M761K probably damaging Het
Vps13b C T 15: 35,910,718 Q3543* probably null Het
Wdr37 T C 13: 8,854,029 E101G possibly damaging Het
Zc3hc1 A G 6: 30,374,900 V214A probably benign Het
Zcchc9 A T 13: 91,800,609 probably null Het
Zdbf2 A T 1: 63,308,792 Q2110L possibly damaging Het
Zfp516 T G 18: 82,957,111 L478R possibly damaging Het
Other mutations in Tmem63c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Tmem63c APN 12 87077206 missense probably benign 0.05
IGL00837:Tmem63c APN 12 87077197 missense probably benign
IGL01317:Tmem63c APN 12 87071996 splice site probably benign
IGL01521:Tmem63c APN 12 87069144 missense probably damaging 0.99
IGL01955:Tmem63c APN 12 87077208 missense probably benign 0.00
IGL02007:Tmem63c APN 12 87072873 missense probably damaging 1.00
IGL02891:Tmem63c APN 12 87071268 missense probably benign 0.00
IGL03102:Tmem63c APN 12 87065549 missense probably benign 0.42
IGL03273:Tmem63c APN 12 87081802 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0975:Tmem63c UTSW 12 87075069 splice site probably benign
R2398:Tmem63c UTSW 12 87056533 missense probably damaging 1.00
R4416:Tmem63c UTSW 12 87081902 missense probably benign 0.14
R4881:Tmem63c UTSW 12 87086418 missense possibly damaging 0.67
R4888:Tmem63c UTSW 12 87089365 missense probably damaging 1.00
R5210:Tmem63c UTSW 12 87089398 missense probably benign 0.10
R5277:Tmem63c UTSW 12 87057757 unclassified probably null
R5790:Tmem63c UTSW 12 87057636 missense probably benign 0.10
R5855:Tmem63c UTSW 12 87075726 missense probably damaging 1.00
R5940:Tmem63c UTSW 12 87075172 missense probably benign
R6000:Tmem63c UTSW 12 87057197 missense probably damaging 1.00
R6240:Tmem63c UTSW 12 87076405 missense possibly damaging 0.67
R6268:Tmem63c UTSW 12 87081953 missense probably damaging 1.00
R6749:Tmem63c UTSW 12 87075665 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAAAGGGACAGCTCCTC -3'
(R):5'- GACACAAACATGGCTTTGTGC -3'

Sequencing Primer
(F):5'- GACAACTTATCATCTGATATGGGGG -3'
(R):5'- AGTGATGGCTGCCCTTCG -3'
Posted On2015-10-21