Incidental Mutation 'R4881:Tmem63c'
ID375294
Institutional Source Beutler Lab
Gene Symbol Tmem63c
Ensembl Gene ENSMUSG00000034145
Gene Nametransmembrane protein 63c
Synonyms9330187M14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R4881 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87021340-87090043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87086418 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 736 (T736S)
Ref Sequence ENSEMBL: ENSMUSP00000119872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110187] [ENSMUST00000131878] [ENSMUST00000146292] [ENSMUST00000154801]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110187
AA Change: T736S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105816
Gene: ENSMUSG00000034145
AA Change: T736S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000131878
AA Change: T736S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117023
Gene: ENSMUSG00000034145
AA Change: T736S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146292
AA Change: T736S

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119872
Gene: ENSMUSG00000034145
AA Change: T736S

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 1.6e-20 PFAM
Pfam:PHM7_cyt 253 323 6e-12 PFAM
Pfam:RSN1_7TM 341 680 2.5e-88 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154801
SMART Domains Protein: ENSMUSP00000119898
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 179 1.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220808
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,278,249 L1040P possibly damaging Het
Acot11 C A 4: 106,755,305 probably null Het
Aldoart2 C A 12: 55,566,114 Q275K probably damaging Het
Auts2 T C 5: 131,472,450 T42A probably damaging Het
Bora C T 14: 99,061,567 L187F probably damaging Het
Cbln4 A G 2: 172,042,139 S54P possibly damaging Het
Celsr3 T A 9: 108,843,941 L2661Q probably damaging Het
Cfap65 T C 1: 74,907,613 T1313A probably damaging Het
Dbndd2 C A 2: 164,490,305 probably benign Het
Dennd4a A G 9: 64,838,844 D4G possibly damaging Het
Dmxl1 T A 18: 49,957,281 probably benign Het
Dnah7b T C 1: 46,201,318 C1532R probably damaging Het
Erbb3 A T 10: 128,576,947 H591Q probably benign Het
Exosc4 T C 15: 76,329,570 L198P probably damaging Het
F2r A T 13: 95,618,329 C16S possibly damaging Het
Fam129b C A 2: 32,922,578 Y446* probably null Het
Gtf2h4 A T 17: 35,670,233 I234N possibly damaging Het
Ift27 A T 15: 78,165,248 V84D probably damaging Het
Ints10 C T 8: 68,810,604 A389V probably benign Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Klrc2 T A 6: 129,660,508 T17S possibly damaging Het
Matr3 T A 18: 35,572,375 S118T probably damaging Het
Mfsd6l C T 11: 68,557,922 A533V probably benign Het
Msh3 A G 13: 92,266,041 probably benign Het
Myo5c A G 9: 75,284,152 M1103V probably benign Het
Olfr1336 A T 7: 6,460,754 M82L probably benign Het
Olfr1391 T A 11: 49,328,297 D295E probably benign Het
Olfr513 T C 7: 108,755,405 L183P probably damaging Het
Osbpl3 A T 6: 50,352,784 D88E possibly damaging Het
Pou1f1 C T 16: 65,531,842 T149I probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Pstpip2 T A 18: 77,874,332 Y267* probably null Het
Rcor1 A G 12: 111,097,552 D95G probably damaging Het
Rttn T C 18: 89,101,685 L1748P probably damaging Het
Slco2a1 A G 9: 103,085,832 K629E possibly damaging Het
Smarcc1 A G 9: 110,135,628 probably benign Het
Son A G 16: 91,675,509 K360E probably benign Het
Stab1 A T 14: 31,143,672 M1753K probably benign Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tmpo G A 10: 91,162,641 P428L possibly damaging Het
Tmprss11a G T 5: 86,422,573 Q176K probably damaging Het
Trappc4 A G 9: 44,404,025 S219P probably damaging Het
Vmn2r117 G T 17: 23,477,885 P183T probably damaging Het
Vmn2r54 C T 7: 12,629,671 V432I probably benign Het
Vtcn1 G A 3: 100,892,593 G257R probably benign Het
Yipf1 T A 4: 107,345,091 M217K possibly damaging Het
Zfc3h1 T C 10: 115,400,742 S374P probably benign Het
Zfp407 T C 18: 84,559,703 H1095R probably benign Het
Zfp661 A T 2: 127,578,644 H78Q probably benign Het
Zfp957 T C 14: 79,213,409 T317A unknown Het
Zfyve9 T A 4: 108,727,491 probably null Het
Other mutations in Tmem63c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Tmem63c APN 12 87077206 missense probably benign 0.05
IGL00837:Tmem63c APN 12 87077197 missense probably benign
IGL01317:Tmem63c APN 12 87071996 splice site probably benign
IGL01521:Tmem63c APN 12 87069144 missense probably damaging 0.99
IGL01955:Tmem63c APN 12 87077208 missense probably benign 0.00
IGL02007:Tmem63c APN 12 87072873 missense probably damaging 1.00
IGL02891:Tmem63c APN 12 87071268 missense probably benign 0.00
IGL03102:Tmem63c APN 12 87065549 missense probably benign 0.42
IGL03273:Tmem63c APN 12 87081802 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0975:Tmem63c UTSW 12 87075069 splice site probably benign
R2398:Tmem63c UTSW 12 87056533 missense probably damaging 1.00
R4416:Tmem63c UTSW 12 87081902 missense probably benign 0.14
R4721:Tmem63c UTSW 12 87057180 missense possibly damaging 0.70
R4888:Tmem63c UTSW 12 87089365 missense probably damaging 1.00
R5210:Tmem63c UTSW 12 87089398 missense probably benign 0.10
R5277:Tmem63c UTSW 12 87057757 unclassified probably null
R5790:Tmem63c UTSW 12 87057636 missense probably benign 0.10
R5855:Tmem63c UTSW 12 87075726 missense probably damaging 1.00
R5940:Tmem63c UTSW 12 87075172 missense probably benign
R6000:Tmem63c UTSW 12 87057197 missense probably damaging 1.00
R6240:Tmem63c UTSW 12 87076405 missense possibly damaging 0.67
R6268:Tmem63c UTSW 12 87081953 missense probably damaging 1.00
R6749:Tmem63c UTSW 12 87075665 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGTTTAGAATGTGGCTTAG -3'
(R):5'- TCCTGCTGTATCAGAACAGGG -3'

Sequencing Primer
(F):5'- GGAAAAGTTGAGGGGTCATGGTG -3'
(R):5'- TGCTGTATCAGAACAGGGAACCC -3'
Posted On2016-03-17