Incidental Mutation 'R4768:Atxn1'
ID 366296
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Name ataxin 1
Synonyms Atx1, Sca1, 2900016G23Rik
MMRRC Submission 042409-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4768 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 45703231-46118467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45711024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 636 (V636A)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
AlphaFold P54254
Predicted Effect probably damaging
Transcript: ENSMUST00000091628
AA Change: V628A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: V628A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167708
AA Change: V628A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: V628A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180110
AA Change: V636A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: V636A

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222227
Meta Mutation Damage Score 0.8449 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm A G 3: 153,628,579 (GRCm39) Y419H probably benign Het
Adam28 A G 14: 68,872,264 (GRCm39) V326A possibly damaging Het
Amdhd1 T A 10: 93,370,346 (GRCm39) E164V possibly damaging Het
Arhgap5 T C 12: 52,604,275 (GRCm39) L29S probably damaging Het
Asb5 G A 8: 55,038,031 (GRCm39) D185N probably benign Het
Ascc3 T C 10: 50,576,595 (GRCm39) I850T probably damaging Het
Bmp4 C T 14: 46,623,381 (GRCm39) R55Q probably damaging Het
Brd8dc T C 18: 34,714,005 (GRCm39) R207G probably damaging Het
Cmas T C 6: 142,710,157 (GRCm39) probably null Het
Dchs1 T C 7: 105,420,827 (GRCm39) D531G possibly damaging Het
Etv1 T C 12: 38,877,792 (GRCm39) L44P probably damaging Het
Fam13c T A 10: 70,387,580 (GRCm39) I448N probably damaging Het
Fcsk T C 8: 111,618,766 (GRCm39) T331A probably benign Het
Fut8 A G 12: 77,412,054 (GRCm39) K135E probably benign Het
Gabrg1 A G 5: 70,911,516 (GRCm39) F370S probably damaging Het
Ighv1-5 A T 12: 114,477,143 (GRCm39) M53K probably damaging Het
Igkv9-120 G T 6: 68,027,351 (GRCm39) R88S possibly damaging Het
Kansl1l A G 1: 66,840,292 (GRCm39) V336A probably damaging Het
Krt27 T A 11: 99,240,351 (GRCm39) D189V probably damaging Het
Marf1 A T 16: 13,949,461 (GRCm39) F1033I possibly damaging Het
Mdfi G A 17: 48,135,475 (GRCm39) T85M probably damaging Het
Mrgpra3 C A 7: 47,239,476 (GRCm39) R150L possibly damaging Het
Mst1r C A 9: 107,788,849 (GRCm39) T456K probably damaging Het
Myh14 A T 7: 44,263,099 (GRCm39) M1734K probably benign Het
Myo1e T C 9: 70,277,751 (GRCm39) I816T possibly damaging Het
Or7d10 A C 9: 19,831,841 (GRCm39) N112T possibly damaging Het
Or8b12 T C 9: 37,658,177 (GRCm39) L249P probably damaging Het
Or8b55 T A 9: 38,727,245 (GRCm39) Y149N probably damaging Het
Or8k28 A T 2: 86,285,994 (GRCm39) L207* probably null Het
Pde4d A G 13: 110,070,408 (GRCm39) R6G probably damaging Het
Pilrb1 G A 5: 137,855,788 (GRCm39) probably benign Het
Prrx1 A G 1: 163,085,334 (GRCm39) Y199H probably damaging Het
Rxfp1 T C 3: 79,594,175 (GRCm39) D73G probably damaging Het
Ryr1 G T 7: 28,704,246 (GRCm39) probably benign Het
Shprh A G 10: 11,057,284 (GRCm39) E1068G probably damaging Het
Slc19a3 G A 1: 83,000,834 (GRCm39) T61I probably damaging Het
Slc9a2 G A 1: 40,765,534 (GRCm39) R308Q probably damaging Het
Suclg2 T G 6: 95,543,469 (GRCm39) I321L probably damaging Het
Top3a A G 11: 60,653,316 (GRCm39) F53L probably damaging Het
Ttn C T 2: 76,599,110 (GRCm39) probably benign Het
Upp2 T C 2: 58,667,907 (GRCm39) V182A probably damaging Het
Vmn2r65 A G 7: 84,596,602 (GRCm39) L151P probably damaging Het
Xylt2 T C 11: 94,561,298 (GRCm39) D155G probably benign Het
Zzz3 A G 3: 152,154,420 (GRCm39) D557G probably damaging Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45,721,903 (GRCm39) utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45,720,669 (GRCm39) missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45,710,790 (GRCm39) missense probably benign 0.00
IGL01512:Atxn1 APN 13 45,720,077 (GRCm39) missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45,720,198 (GRCm39) missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45,721,701 (GRCm39) missense probably benign 0.00
IGL02333:Atxn1 APN 13 45,720,680 (GRCm39) missense probably damaging 1.00
Cormorant UTSW 13 45,710,545 (GRCm39) missense probably damaging 1.00
pelagic UTSW 13 45,720,288 (GRCm39) missense probably benign 0.05
R0136:Atxn1 UTSW 13 45,720,645 (GRCm39) missense probably damaging 0.99
R0180:Atxn1 UTSW 13 45,711,024 (GRCm39) missense probably damaging 1.00
R0299:Atxn1 UTSW 13 45,720,645 (GRCm39) missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45,711,006 (GRCm39) missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45,710,899 (GRCm39) missense probably benign 0.08
R1484:Atxn1 UTSW 13 45,711,052 (GRCm39) nonsense probably null
R1532:Atxn1 UTSW 13 45,720,386 (GRCm39) missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45,721,280 (GRCm39) missense probably benign 0.27
R2277:Atxn1 UTSW 13 45,710,544 (GRCm39) missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45,720,175 (GRCm39) missense probably damaging 1.00
R2849:Atxn1 UTSW 13 45,720,175 (GRCm39) missense probably damaging 1.00
R4326:Atxn1 UTSW 13 46,119,443 (GRCm39) unclassified probably benign
R4626:Atxn1 UTSW 13 45,720,575 (GRCm39) missense probably damaging 1.00
R4944:Atxn1 UTSW 13 45,720,407 (GRCm39) missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45,710,545 (GRCm39) missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45,710,569 (GRCm39) missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45,721,844 (GRCm39) missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45,710,730 (GRCm39) missense probably benign 0.14
R5561:Atxn1 UTSW 13 45,720,347 (GRCm39) missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45,710,853 (GRCm39) missense probably benign 0.17
R6092:Atxn1 UTSW 13 45,720,288 (GRCm39) missense probably benign 0.05
R6272:Atxn1 UTSW 13 45,721,238 (GRCm39) missense possibly damaging 0.49
R6372:Atxn1 UTSW 13 45,710,932 (GRCm39) missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45,721,147 (GRCm39) missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45,721,095 (GRCm39) missense probably benign 0.04
R7041:Atxn1 UTSW 13 45,720,311 (GRCm39) missense probably damaging 1.00
R7578:Atxn1 UTSW 13 45,720,834 (GRCm39) missense probably benign 0.02
R7600:Atxn1 UTSW 13 45,710,536 (GRCm39) missense possibly damaging 0.90
R8112:Atxn1 UTSW 13 45,721,433 (GRCm39) missense probably benign
R8297:Atxn1 UTSW 13 45,720,505 (GRCm39) missense probably benign
R8411:Atxn1 UTSW 13 45,720,032 (GRCm39) missense probably benign 0.02
R8482:Atxn1 UTSW 13 45,721,426 (GRCm39) missense possibly damaging 0.75
R9022:Atxn1 UTSW 13 45,720,891 (GRCm39) missense probably damaging 1.00
R9269:Atxn1 UTSW 13 45,710,680 (GRCm39) missense probably benign 0.01
R9310:Atxn1 UTSW 13 45,721,494 (GRCm39) missense probably damaging 1.00
R9514:Atxn1 UTSW 13 45,721,433 (GRCm39) missense probably benign
R9626:Atxn1 UTSW 13 45,710,796 (GRCm39) missense possibly damaging 0.92
R9673:Atxn1 UTSW 13 45,710,622 (GRCm39) missense probably benign 0.01
R9744:Atxn1 UTSW 13 45,721,299 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCTGTGTCTGCTGCCAGC -3'
(R):5'- AGAACTCACACCCAAGGTTGAG -3'

Sequencing Primer
(F):5'- CAGGCTGTCGGTCTTTGCC -3'
(R):5'- ACCCAAGGTTGAGCTCCAG -3'
Posted On 2015-12-21