Incidental Mutation 'R4812:Mecom'
ID369504
Institutional Source Beutler Lab
Gene Symbol Mecom
Ensembl Gene ENSMUSG00000027684
Gene NameMDS1 and EVI1 complex locus
SynonymsEvi1, Jbo, D630039M04Rik, ZNFPR1B1, Evi-1, Prdm3, Mds1, MDS1-EVI1
MMRRC Submission 042431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4812 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location29951296-30548008 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 30140368 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000103906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108271] [ENSMUST00000172697] [ENSMUST00000172754] [ENSMUST00000173495] [ENSMUST00000173899]
Predicted Effect probably null
Transcript: ENSMUST00000108271
AA Change: M1R
SMART Domains Protein: ENSMUSP00000103906
Gene: ENSMUSG00000027684
AA Change: M1R

DomainStartEndE-ValueType
Blast:SET 9 85 3e-44 BLAST
PDB:2JV0|A 25 96 2e-12 PDB
ZnF_C2H2 98 118 1.86e1 SMART
ZnF_C2H2 152 174 4.47e-3 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 231 1.13e-4 SMART
ZnF_C2H2 237 259 1.2e-3 SMART
ZnF_C2H2 477 499 5.29e-5 SMART
ZnF_C2H2 505 528 1.6e-4 SMART
ZnF_C2H2 534 556 5.9e-3 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 778 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172697
SMART Domains Protein: ENSMUSP00000134117
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 923 945 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172754
Predicted Effect probably benign
Transcript: ENSMUST00000173059
SMART Domains Protein: ENSMUSP00000133310
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 15 133 5.46e-15 SMART
ZnF_C2H2 146 166 1.86e1 SMART
ZnF_C2H2 200 222 4.47e-3 SMART
ZnF_C2H2 228 250 1.6e-4 SMART
ZnF_C2H2 256 279 1.13e-4 SMART
ZnF_C2H2 285 307 1.2e-3 SMART
ZnF_C2H2 525 547 5.29e-5 SMART
ZnF_C2H2 553 576 1.6e-4 SMART
ZnF_C2H2 582 604 5.9e-3 SMART
low complexity region 678 697 N/A INTRINSIC
low complexity region 826 841 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173411
Predicted Effect probably benign
Transcript: ENSMUST00000173495
SMART Domains Protein: ENSMUSP00000134626
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
ZnF_C2H2 21 41 8e-2 SMART
ZnF_C2H2 75 97 1.9e-5 SMART
ZnF_C2H2 103 125 7e-7 SMART
ZnF_C2H2 131 154 4.8e-7 SMART
ZnF_C2H2 160 182 5e-6 SMART
ZnF_C2H2 188 210 3.5e-4 SMART
ZnF_C2H2 217 244 4.3e-2 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 2.2e-7 SMART
ZnF_C2H2 761 784 7.1e-7 SMART
ZnF_C2H2 790 812 2.5e-5 SMART
low complexity region 886 905 N/A INTRINSIC
low complexity region 1034 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173899
SMART Domains Protein: ENSMUSP00000133410
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 914 936 5.29e-5 SMART
ZnF_C2H2 942 965 1.6e-4 SMART
ZnF_C2H2 971 993 5.9e-3 SMART
Meta Mutation Damage Score 0.6344 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (124/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at 10.5 dpc displaying widespread hypocellularity, hemorrhage, and disruption in the development of the heart, somites, and neural crest-derived cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik C T 3: 40,521,484 noncoding transcript Het
2410089E03Rik T G 15: 8,201,123 probably null Het
Abca5 T C 11: 110,301,821 D681G probably damaging Het
Actl11 T C 9: 107,931,130 V884A probably damaging Het
Akr1c14 G A 13: 4,079,165 V187M probably damaging Het
Apbb1 A T 7: 105,574,025 N126K probably damaging Het
Armc4 T G 18: 7,288,634 T78P possibly damaging Het
Bmt2 G T 6: 13,677,800 R12S unknown Het
Btrc G A 19: 45,423,164 C9Y possibly damaging Het
C5ar1 A C 7: 16,248,333 probably null Het
C8a C T 4: 104,862,591 probably null Het
Cabin1 A G 10: 75,646,594 S2172P possibly damaging Het
Calcoco2 T C 11: 96,107,450 D49G probably damaging Het
Camta1 C T 4: 151,131,542 D974N probably null Het
Car6 T C 4: 150,197,415 E47G probably damaging Het
Ccdc105 T C 10: 78,749,216 H262R probably benign Het
Ccnd3 G A 17: 47,597,580 probably null Het
Celf5 A T 10: 81,470,739 V30E probably damaging Het
Cfap46 T A 7: 139,636,000 D1513V probably damaging Het
Cinp T C 12: 110,879,740 Y84C probably damaging Het
Cnih1 A G 14: 46,776,544 I154T probably damaging Het
Col15a1 C T 4: 47,262,479 P511L possibly damaging Het
Col4a4 C T 1: 82,462,153 V1364M unknown Het
Crtam A G 9: 40,984,325 L38P probably damaging Het
Ctnna1 T A 18: 35,239,477 V495D probably damaging Het
Cubn T C 2: 13,459,076 Y606C probably damaging Het
Cyp4f16 C T 17: 32,546,678 A345V probably null Het
Dctn1 A T 6: 83,189,937 M160L probably benign Het
Dip2c T A 13: 9,637,130 C366* probably null Het
Dnajc2 G A 5: 21,763,486 S401L probably benign Het
Dnmt3l A G 10: 78,057,294 I302V probably benign Het
Dvl2 T C 11: 70,011,293 probably benign Het
Edn1 T G 13: 42,303,640 S50A probably benign Het
Efhc1 A T 1: 20,990,647 R636W probably damaging Het
Epg5 T A 18: 77,979,184 H1047Q probably benign Het
Etv1 T G 12: 38,861,288 V371G probably damaging Het
Fam71e2 G A 7: 4,759,072 T295M probably damaging Het
Fap T A 2: 62,519,021 I475F probably damaging Het
Fbxw15 T C 9: 109,559,922 I140V probably benign Het
Fer A G 17: 63,934,297 T311A probably benign Het
Fh1 A G 1: 175,601,459 W497R probably damaging Het
Flot2 T A 11: 78,053,365 L45Q probably damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fmnl1 T C 11: 103,198,564 probably benign Het
Ggta1 C T 2: 35,402,723 V203I probably benign Het
Gm19345 C T 7: 19,857,873 V204M probably damaging Het
Gm4204 T A 1: 135,232,489 noncoding transcript Het
Gm6124 C G 7: 39,222,895 noncoding transcript Het
Gprin3 T A 6: 59,353,365 K652N possibly damaging Het
Gucy1b2 T C 14: 62,415,897 probably null Het
Hace1 C A 10: 45,686,603 A738E probably benign Het
Hectd1 C T 12: 51,827,351 probably null Het
Hnrnpdl T C 5: 100,036,472 probably benign Het
Hyou1 T C 9: 44,387,121 probably benign Het
Ifi44l G A 3: 151,759,699 A138V probably benign Het
Igkv16-104 A T 6: 68,425,845 I41F possibly damaging Het
Ints7 T A 1: 191,594,430 D171E possibly damaging Het
Kmt2a A T 9: 44,831,354 probably benign Het
Kmt2e T C 5: 23,502,587 V1716A possibly damaging Het
Krtap5-1 G A 7: 142,296,891 S60F unknown Het
Lama4 G A 10: 39,072,769 V843I probably benign Het
Laptm5 A G 4: 130,913,438 probably null Het
Lbhd1 G A 19: 8,889,174 A193T probably damaging Het
Lce3f C T 3: 92,992,940 P23S unknown Het
Lrmp G A 6: 145,148,011 G120S probably damaging Het
Mindy4 A C 6: 55,279,103 T531P possibly damaging Het
Mrpl3 A G 9: 105,073,824 N263S probably damaging Het
Myo18b T C 5: 112,809,718 K1460E possibly damaging Het
Myof A G 19: 37,916,559 Y852H probably damaging Het
Nefl T G 14: 68,084,285 V108G probably damaging Het
Nid1 T A 13: 13,506,468 L1061* probably null Het
Nim1k T A 13: 119,712,384 M325L probably benign Het
Nlrp1c-ps T C 11: 71,252,305 noncoding transcript Het
Npsr1 C T 9: 24,289,956 T59I probably damaging Het
Nr2c1 A G 10: 94,188,252 T440A probably benign Het
Nup160 C T 2: 90,725,691 T1245I probably damaging Het
Nup88 T A 11: 70,965,726 T194S probably damaging Het
Oas3 A G 5: 120,761,147 probably benign Het
Olfr1129 A G 2: 87,575,743 I220V probably benign Het
Olfr1274-ps T A 2: 90,401,096 M145K probably benign Het
Olfr1393 T A 11: 49,280,457 I103K possibly damaging Het
Opn1sw A T 6: 29,378,039 M252K probably damaging Het
Oprm1 T G 10: 6,832,698 probably benign Het
Pcdha2 T A 18: 36,939,808 V164E probably benign Het
Pclo A G 5: 14,540,025 T780A unknown Het
Pcnx2 T A 8: 125,865,939 Q762L probably benign Het
Pcyt2 A T 11: 120,614,425 probably benign Het
Pdpr A G 8: 111,116,717 N294D probably benign Het
Perm1 T A 4: 156,218,736 V579E possibly damaging Het
Pgk2 T A 17: 40,207,390 K382N possibly damaging Het
Plcb4 T A 2: 136,007,881 L205Q probably damaging Het
Plekha3 C T 2: 76,686,631 T109I probably damaging Het
Pnn T A 12: 59,071,618 V329E possibly damaging Het
Ptpn13 A G 5: 103,523,615 I469M probably benign Het
Rapgef3 A G 15: 97,753,803 V603A probably benign Het
Rbms1 C T 2: 60,792,769 V75I possibly damaging Het
Rbp3 T A 14: 33,954,774 D226E probably damaging Het
Robo2 A T 16: 73,916,288 N1189K probably benign Het
Rragd A G 4: 33,018,766 T270A probably benign Het
Rxfp1 T A 3: 79,650,582 T530S probably benign Het
Ryr3 T C 2: 112,912,236 E479G probably damaging Het
Scd2 A T 19: 44,301,402 I279F probably damaging Het
Sh3d19 A T 3: 86,123,767 D746V probably damaging Het
Shroom4 A G X: 6,624,126 K1133E probably benign Het
Sirpb1c A G 3: 15,833,222 V151A probably damaging Het
Slc26a2 A T 18: 61,202,021 I120N probably damaging Het
Slco1a1 A G 6: 141,918,593 S494P probably damaging Het
Srebf2 A T 15: 82,203,825 T1061S probably damaging Het
Sspo T C 6: 48,490,510 L4202P probably benign Het
Synj2 G A 17: 6,010,664 G215E probably damaging Het
Tbc1d19 T C 5: 53,809,806 V16A probably damaging Het
Tiparp T C 3: 65,552,769 I495T possibly damaging Het
Tipin A G 9: 64,304,412 H260R probably benign Het
Tle1 A G 4: 72,145,354 S221P probably damaging Het
Tmem94 T A 11: 115,796,112 L1101* probably null Het
Trim43b C T 9: 89,091,480 D67N probably benign Het
Ubn2 T A 6: 38,463,726 C178S probably benign Het
Vmn1r54 T C 6: 90,269,325 F74L probably benign Het
Vmn2r24 A G 6: 123,779,185 H72R probably benign Het
Wdr66 G A 5: 123,287,305 V776I probably benign Het
Wnk1 C T 6: 119,952,771 V850I probably benign Het
Zan T G 5: 137,456,285 Y1419S unknown Het
Zbtb14 T A 17: 69,387,582 Y92N probably damaging Het
Zfand5 A G 19: 21,277,737 K116E probably benign Het
Zfhx3 A G 8: 108,947,961 E1881G possibly damaging Het
Zfp280b A G 10: 76,039,090 K268E probably benign Het
Zfp541 A G 7: 16,079,110 I563V probably benign Het
Zfy2 T A Y: 2,106,334 I767L probably benign Het
Other mutations in Mecom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Mecom APN 3 29963166 missense probably damaging 0.99
IGL02800:Mecom APN 3 29961034 missense probably damaging 1.00
IGL03052:Mecom APN 3 29960963 splice site probably benign
IGL03237:Mecom APN 3 29956499 intron probably benign
R0004:Mecom UTSW 3 29979911 missense probably damaging 1.00
R0299:Mecom UTSW 3 29980411 missense probably benign 0.41
R0324:Mecom UTSW 3 29963112 missense probably damaging 0.99
R0485:Mecom UTSW 3 29980972 intron probably benign
R0696:Mecom UTSW 3 29956389 missense probably benign 0.01
R1322:Mecom UTSW 3 29957373 missense probably damaging 0.98
R1396:Mecom UTSW 3 29979800 missense possibly damaging 0.50
R1419:Mecom UTSW 3 29980889 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1487:Mecom UTSW 3 29980064 missense probably damaging 1.00
R1620:Mecom UTSW 3 29987088 missense probably damaging 1.00
R1867:Mecom UTSW 3 30509428 critical splice donor site probably null
R1876:Mecom UTSW 3 29993658 missense probably damaging 1.00
R1922:Mecom UTSW 3 29957442 missense probably damaging 0.99
R2044:Mecom UTSW 3 29980592 missense probably damaging 1.00
R2087:Mecom UTSW 3 29952814 missense probably benign 0.01
R2116:Mecom UTSW 3 29965458 missense probably damaging 1.00
R3500:Mecom UTSW 3 29980912 missense probably damaging 1.00
R4348:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4350:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4351:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4352:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4353:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4358:Mecom UTSW 3 29979785 nonsense probably null
R4370:Mecom UTSW 3 29957355 missense probably damaging 1.00
R4380:Mecom UTSW 3 29987070 missense probably damaging 1.00
R4676:Mecom UTSW 3 30268668 intron probably benign
R4690:Mecom UTSW 3 30238310 missense probably benign 0.01
R4750:Mecom UTSW 3 29957530 missense probably damaging 0.97
R4821:Mecom UTSW 3 29985351 missense probably damaging 1.00
R4986:Mecom UTSW 3 29980699 missense probably damaging 0.99
R5020:Mecom UTSW 3 29961106 missense probably damaging 1.00
R5099:Mecom UTSW 3 29985316 intron probably benign
R5410:Mecom UTSW 3 29997721 missense probably benign 0.01
R5415:Mecom UTSW 3 29957526 missense possibly damaging 0.93
R5556:Mecom UTSW 3 30238100 missense probably damaging 1.00
R5811:Mecom UTSW 3 29961000 missense probably benign 0.00
R5955:Mecom UTSW 3 29961046 missense probably damaging 1.00
R6153:Mecom UTSW 3 29993648 missense possibly damaging 0.92
R6321:Mecom UTSW 3 29980592 missense probably damaging 1.00
R6335:Mecom UTSW 3 29980756 missense probably damaging 1.00
R6383:Mecom UTSW 3 29997726 missense probably damaging 1.00
R6435:Mecom UTSW 3 29980249 missense probably damaging 1.00
R6468:Mecom UTSW 3 30140386 intron probably benign
R6476:Mecom UTSW 3 29980568 missense possibly damaging 0.70
R6673:Mecom UTSW 3 29980702 missense probably benign 0.09
R6721:Mecom UTSW 3 29979874 missense probably damaging 1.00
R7071:Mecom UTSW 3 29980708 missense probably damaging 1.00
R7095:Mecom UTSW 3 29980954 missense probably damaging 1.00
R7131:Mecom UTSW 3 29980945 missense probably damaging 1.00
R7247:Mecom UTSW 3 30140356 missense unknown
R7265:Mecom UTSW 3 29980133 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AACCAGCCACCTTTTACAGTTC -3'
(R):5'- ATAATGCTCCTACAGAGGGACC -3'

Sequencing Primer
(F):5'- GCCACCTTTTACAGTTCAGAAC -3'
(R):5'- GTTCCCAGGCCCTCCACTG -3'
Posted On2016-02-04