Incidental Mutation 'R4816:Pkhd1'
ID369754
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Namepolycystic kidney and hepatic disease 1
SynonymsFPC, tigmin
MMRRC Submission 042434-MU
Accession Numbers

Genbank: NM_153179; MGI: 2155808

Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R4816 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20057779-20618064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20199415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 3302 (I3302L)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
Predicted Effect probably damaging
Transcript: ENSMUST00000088448
AA Change: I3302L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: I3302L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20566874 critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20524070 missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20081184 critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20571390 missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20117747 missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20523258 missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20209176 missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20534530 splice site probably benign
IGL01313:Pkhd1 APN 1 20201024 missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20522977 missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20549715 missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20199459 missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20559419 critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20116979 missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20534633 nonsense probably null
IGL01790:Pkhd1 APN 1 20558671 missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20358910 missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20103235 missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20220083 missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20198137 missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20523567 missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20522747 missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20201227 missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20377399 missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20117195 missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20275615 missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20584101 missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20209260 missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20070376 critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20200783 missense probably benign
IGL02389:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20199486 missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20562418 missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20414421 missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20522759 missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20364201 missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20392165 missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20073507 missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20310710 missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20520256 missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20550902 missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20558752 missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20220029 splice site probably benign
IGL02752:Pkhd1 APN 1 20553591 missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20361011 missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20608416 nonsense probably null
IGL02960:Pkhd1 APN 1 20377446 missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20522963 missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20522699 missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20565633 missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20198171 missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20201019 missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20081300 splice site probably benign
IGL03375:Pkhd1 APN 1 20117023 missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20200670 missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20522894 missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20537365 missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20611414 intron probably benign
P0035:Pkhd1 UTSW 1 20117347 missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20222906 missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0115:Pkhd1 UTSW 1 20350490 missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20358917 missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20540400 missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20549822 splice site probably null
R0323:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20381547 missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20117788 missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20559469 missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20310514 splice site probably benign
R0550:Pkhd1 UTSW 1 20347223 missense probably null 1.00
R0584:Pkhd1 UTSW 1 20239436 nonsense probably null
R0586:Pkhd1 UTSW 1 20524111 missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20200890 missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20117173 missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20117474 missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20524230 missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20198107 missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20117484 missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20350521 missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20199381 missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20201259 missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20117726 missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20522829 missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20567456 missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20571405 missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20555223 splice site probably benign
R1411:Pkhd1 UTSW 1 20373896 missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20534558 missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20522983 missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20117780 missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20117401 missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20347440 missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20117825 missense probably benign
R1617:Pkhd1 UTSW 1 20198050 missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20522897 missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20584129 missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20550840 splice site probably benign
R1753:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20565711 missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20585152 splice site probably benign
R1822:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20117069 missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20615267 critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20566756 critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20081300 splice site probably benign
R1969:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20117060 missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20199459 missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20200669 missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20612812 missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20201335 missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20553574 nonsense probably null
R2142:Pkhd1 UTSW 1 20523895 missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20414220 critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20553517 missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20537360 missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20565639 missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20534535 critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20200849 missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20200855 missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20201165 missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20209182 missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20222961 missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20104599 missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20555129 missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20585655 missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20058300 makesense probably null
R3838:Pkhd1 UTSW 1 20534629 missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20558723 missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20200927 missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20312138 nonsense probably null
R3926:Pkhd1 UTSW 1 20550873 missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20209277 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20563686 missense probably benign 0.06
R4255:Pkhd1 UTSW 1 20593934 missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20058384 missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20058617 missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20414292 missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20239411 missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20523314 missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20211858 missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20534719 missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20613409 missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20200868 missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20503056 missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20364167 missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20081228 missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20524130 missense probably benign
R4750:Pkhd1 UTSW 1 20524112 missense possibly damaging 0.57
R4825:Pkhd1 UTSW 1 20537401 missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20070488 missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20209226 missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20288205 missense probably null 0.01
R5062:Pkhd1 UTSW 1 20585711 missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20200757 missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20585191 missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20209224 missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20547341 missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20275641 missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20534545 missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20350411 critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20565870 missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20450304 missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20392097 missense probably benign
R5346:Pkhd1 UTSW 1 20523434 missense probably damaging 0.96
R5431:Pkhd1 UTSW 1 20117836 missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20239385 missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20201156 missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20377404 missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20081252 missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20523142 missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20073526 missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20558626 missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20588531 missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20547461 missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20523651 nonsense probably null
R5760:Pkhd1 UTSW 1 20073554 missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20209185 missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20058600 missense probably benign
R5810:Pkhd1 UTSW 1 20200673 missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20199405 missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20058678 missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20201083 missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20381461 missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20374736 nonsense probably null
R5852:Pkhd1 UTSW 1 20377408 missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20520210 missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20523770 missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20211951 missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20551020 missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20585703 missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20200823 missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20612705 missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20058339 missense probably benign
R6886:Pkhd1 UTSW 1 20347280 missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20523515 missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20534701 missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20562451 missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20558719 missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20523126 missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20547519 missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20593953 missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20200973 missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20239304 missense not run
R7436:Pkhd1 UTSW 1 20200701 missense probably benign
R7473:Pkhd1 UTSW 1 20549756 missense probably damaging 0.99
X0012:Pkhd1 UTSW 1 20373926 missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20520226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCAGCCTTTTCTACAGG -3'
(R):5'- TGGATAGCTCAAATTAGTTCCTGG -3'

Sequencing Primer
(F):5'- AGCCTTTTCTACAGGGGTTTATTTC -3'
(R):5'- AGCTCAAATTAGTTCCTGGAATATG -3'
Posted On2016-02-04