Incidental Mutation 'R4895:Olfr988'
ID377542
Institutional Source Beutler Lab
Gene Symbol Olfr988
Ensembl Gene ENSMUSG00000075222
Gene Nameolfactory receptor 988
SynonymsGA_x6K02T2Q125-46830591-46829662, MOR203-5P
MMRRC Submission 042499-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4895 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85352428-85363227 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to T at 85352997 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Lysine at position 310 (*310K)
Ref Sequence ENSEMBL: ENSMUSP00000151211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099928] [ENSMUST00000111597] [ENSMUST00000215511]
Predicted Effect probably null
Transcript: ENSMUST00000099928
AA Change: *310K
SMART Domains Protein: ENSMUSP00000097512
Gene: ENSMUSG00000075222
AA Change: *310K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 3.8e-31 PFAM
Pfam:7tm_4 139 283 3.7e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111597
AA Change: *310K
SMART Domains Protein: ENSMUSP00000107224
Gene: ENSMUSG00000075222
AA Change: *310K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.1e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 284 1.5e-6 PFAM
Pfam:7tm_1 41 290 7.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215511
AA Change: *310K
Meta Mutation Damage Score 0.6556 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519P11Rik C A 2: 154,613,070 probably benign Het
Abat G A 16: 8,615,962 A392T probably benign Het
Abca14 G A 7: 120,247,349 probably null Het
Abcc6 A T 7: 45,980,990 L1282Q possibly damaging Het
Acss2 A G 2: 155,550,481 probably benign Het
Adgrf1 G T 17: 43,310,620 V583L probably benign Het
Aftph T C 11: 20,696,801 D825G probably damaging Het
Ahnak T C 19: 9,017,441 V5363A probably benign Het
Apba3 G A 10: 81,271,283 probably null Het
Asb13 T C 13: 3,643,589 Y116H probably damaging Het
Asb4 C A 6: 5,398,266 T77K probably damaging Het
Atp8b4 A T 2: 126,414,369 H223Q probably benign Het
Best1 A G 19: 9,992,771 L159P probably benign Het
Cacna1h A T 17: 25,389,422 M731K probably damaging Het
Catspere1 T A 1: 177,859,861 noncoding transcript Het
Cenpv A T 11: 62,527,520 Y202* probably null Het
Cep57 A T 9: 13,816,153 probably benign Het
Cfap100 T A 6: 90,406,102 D363V possibly damaging Het
Cluh A G 11: 74,667,405 Y1126C probably damaging Het
Cyp2j5 A G 4: 96,663,110 probably null Het
Dnajc11 T C 4: 151,979,933 F514L probably damaging Het
Efcab3 T A 11: 105,117,401 probably benign Het
Eif2b4 T G 5: 31,192,954 Q8P probably benign Het
Epha6 A T 16: 59,666,555 V1043E probably benign Het
Gm11562 G T 11: 99,620,315 Q20K unknown Het
Gm11639 C T 11: 104,720,286 T318I probably benign Het
Gm11639 A G 11: 104,749,670 D1026G probably damaging Het
Gm13762 A T 2: 88,973,711 F60Y probably benign Het
Gm14415 A T 2: 177,104,321 noncoding transcript Het
Gm5431 A G 11: 48,889,028 S634P probably damaging Het
Gpld1 C A 13: 24,979,728 N501K probably damaging Het
Gsn C T 2: 35,302,578 R513C probably damaging Het
Gulp1 T C 1: 44,788,597 F300L probably benign Het
H2afj T C 6: 136,808,662 V108A possibly damaging Het
Haus3 T C 5: 34,168,070 R82G probably benign Het
Herc2 G A 7: 56,222,986 R4424H probably damaging Het
Hmcn1 T A 1: 150,677,379 Q2520L probably benign Het
Hs2st1 T C 3: 144,465,253 I53V probably benign Het
Inpp5e C T 2: 26,397,912 R624Q probably damaging Het
Ints8 G T 4: 11,230,367 C491* probably null Het
Itpkb C A 1: 180,413,895 A710D probably damaging Het
Kcnk4 A C 19: 6,928,416 probably null Het
Kmt2d T C 15: 98,844,487 probably benign Het
Lamb3 C T 1: 193,332,314 R594* probably null Het
Map3k20 A G 2: 72,402,356 probably benign Het
Maz A T 7: 127,025,300 probably null Het
Mtr T C 13: 12,216,866 T651A probably benign Het
Nbeal1 A G 1: 60,292,903 E2252G probably damaging Het
Ndufa10 A G 1: 92,469,896 Y61H probably damaging Het
Npat T A 9: 53,570,489 L1166M probably damaging Het
Olfr1112 A C 2: 87,191,848 I54L probably benign Het
Olfr1447 C T 19: 12,900,887 V298M probably damaging Het
Olfr190 C T 16: 59,074,657 C141Y probably benign Het
Olfr490 A C 7: 108,286,595 I177S probably damaging Het
Pcdhb3 T C 18: 37,301,706 F242L probably damaging Het
Phip A G 9: 82,959,595 V57A probably benign Het
Plekha7 A T 7: 116,189,391 probably null Het
Pot1a A C 6: 25,753,206 F444V probably damaging Het
Ppm1a C T 12: 72,784,352 P217L probably damaging Het
Prepl A G 17: 85,081,066 F203S probably damaging Het
Prl8a1 T C 13: 27,575,530 I175V probably benign Het
Ranbp6 A T 19: 29,809,775 I1059N possibly damaging Het
Rhag A G 17: 40,811,351 Q59R probably benign Het
Sema4c A C 1: 36,553,570 probably null Het
Sf3b3 T C 8: 110,816,024 D902G probably benign Het
Tbc1d23 A G 16: 57,198,857 probably null Het
Tbrg1 A T 9: 37,655,079 I54N probably damaging Het
Tchh A T 3: 93,445,686 E811V unknown Het
Tenm3 T A 8: 48,300,971 D799V probably damaging Het
Tlr5 T C 1: 182,974,199 L342P probably damaging Het
Tppp C T 13: 74,030,877 R146* probably null Het
Trpm4 A T 7: 45,318,058 M574K probably damaging Het
Uggt1 A T 1: 36,156,264 F1288Y probably damaging Het
Uggt2 T A 14: 119,018,886 K1124N probably damaging Het
Usf3 A C 16: 44,221,096 S1980R possibly damaging Het
Vav2 T C 2: 27,318,961 D100G probably damaging Het
Vmn2r3 G T 3: 64,259,761 H650N probably benign Het
Vmn2r59 T A 7: 42,045,794 Y398F probably damaging Het
Zfp619 A G 7: 39,537,972 D1142G possibly damaging Het
Zfp933 G A 4: 147,826,435 R235* probably null Het
Other mutations in Olfr988
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Olfr988 APN 2 85353662 missense probably benign 0.01
IGL02651:Olfr988 APN 2 85353050 missense probably damaging 1.00
R0505:Olfr988 UTSW 2 85353749 missense possibly damaging 0.87
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1574:Olfr988 UTSW 2 85353899 missense probably damaging 0.97
R1632:Olfr988 UTSW 2 85353242 missense possibly damaging 0.78
R2187:Olfr988 UTSW 2 85353915 missense probably benign
R2251:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2252:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R2253:Olfr988 UTSW 2 85353858 missense possibly damaging 0.87
R3522:Olfr988 UTSW 2 85353003 missense probably benign 0.06
R4804:Olfr988 UTSW 2 85353081 missense probably benign 0.22
R4855:Olfr988 UTSW 2 85353449 missense possibly damaging 0.89
R4918:Olfr988 UTSW 2 85353288 missense probably benign 0.39
R5171:Olfr988 UTSW 2 85353770 missense probably benign 0.11
R5208:Olfr988 UTSW 2 85353798 missense probably benign 0.07
R5938:Olfr988 UTSW 2 85353276 missense probably damaging 1.00
R6088:Olfr988 UTSW 2 85353354 missense probably damaging 0.99
R7213:Olfr988 UTSW 2 85353556 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCAGGCAAAGTTGATTAAGCC -3'
(R):5'- ATGGGACTCTCGCCTACATG -3'

Sequencing Primer
(F):5'- GAGGACCCAAGTTCAGTTTCTCAG -3'
(R):5'- GGGACTCTCGCCTACATGTATCTAC -3'
Posted On2016-03-17