Incidental Mutation 'R4912:Nin'
ID379648
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Nameninein
Synonyms3110068G20Rik
MMRRC Submission 042514-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4912 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location70011435-70113717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70044063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 859 (D859E)
Ref Sequence ENSEMBL: ENSMUSP00000152350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]
Predicted Effect probably damaging
Transcript: ENSMUST00000021468
AA Change: D859E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: D859E

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085314
AA Change: D859E

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: D859E

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095666
AA Change: D859E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: D859E

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169074
AA Change: D859E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: D859E

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect probably benign
Transcript: ENSMUST00000222237
AA Change: D859E

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect probably damaging
Transcript: ENSMUST00000223257
AA Change: D859E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223316
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,856 D52G possibly damaging Het
2810474O19Rik C G 6: 149,329,389 S1311C probably damaging Het
Acaa1a C A 9: 119,342,761 R102S probably damaging Het
Arhgef12 G A 9: 42,993,065 R706* probably null Het
Best3 A G 10: 117,008,981 Y347C probably damaging Het
Birc6 T A 17: 74,565,905 D386E probably damaging Het
C130050O18Rik A T 5: 139,414,389 T66S probably benign Het
Chd9 A T 8: 91,034,230 D2201V possibly damaging Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Dffb T A 4: 153,965,407 probably benign Het
Diaph3 A C 14: 87,007,199 C217W probably damaging Het
Eml2 T A 7: 19,193,999 probably null Het
Ercc5 T C 1: 44,157,057 I70T probably damaging Het
Fryl AGTGTGT AGTGT 5: 73,068,782 probably null Het
Fsd1 C T 17: 55,991,241 P189S possibly damaging Het
Gm42669 A G 5: 107,508,817 K982R probably damaging Het
Gm5414 A G 15: 101,625,010 I373T possibly damaging Het
Gm7356 A G 17: 14,001,236 L177P possibly damaging Het
Grip1 G A 10: 119,931,248 D93N probably damaging Het
Hbq1b T A 11: 32,287,014 M1K probably null Het
Hps3 C A 3: 20,014,173 L572F probably damaging Het
Ighj2 T A 12: 113,429,480 probably benign Het
Kcna3 T C 3: 107,037,891 M490T probably benign Het
Krt76 T A 15: 101,888,162 K404* probably null Het
Lgr4 A T 2: 110,006,502 probably null Het
Ltbp4 G T 7: 27,306,116 C1533* probably null Het
Mapre2 A G 18: 23,832,933 N25S probably damaging Het
Mark3 T A 12: 111,592,653 I43K probably benign Het
Mon1b T A 8: 113,641,953 Y495* probably null Het
Mrfap1 A G 5: 36,796,745 probably benign Het
Mxra8 A G 4: 155,840,904 probably null Het
Myoz1 A T 14: 20,649,538 L244Q probably damaging Het
Ndfip2 C T 14: 105,258,685 R5W probably benign Het
Nek11 T C 9: 105,287,658 D423G probably benign Het
Nup210 G A 6: 91,017,529 A1729V probably benign Het
Olfm3 A G 3: 115,101,940 E157G probably damaging Het
Olfr397 A T 11: 73,965,340 H244L probably damaging Het
Prickle1 A G 15: 93,500,548 S800P probably benign Het
Reln A G 5: 21,925,193 S2707P probably benign Het
Rexo4 G A 2: 26,962,392 T200M possibly damaging Het
Saxo2 T A 7: 82,634,535 I372L probably benign Het
Scgb2b2 T A 7: 31,303,631 D50E probably benign Het
Sipa1l1 T C 12: 82,396,678 L914P possibly damaging Het
Slf1 T A 13: 77,051,294 D656V probably damaging Het
Sorbs1 T C 19: 40,311,727 D1192G probably damaging Het
Tdrd6 A C 17: 43,624,327 D1943E probably benign Het
Tmem163 G A 1: 127,491,625 T281M probably damaging Het
Tmod3 A G 9: 75,532,448 V35A probably damaging Het
Ttc39c A T 18: 12,734,894 Q448L probably benign Het
Ulk1 A T 5: 110,787,589 S937T probably damaging Het
Unc13c T A 9: 73,574,022 D1711V probably damaging Het
Usp5 C G 6: 124,822,630 K318N possibly damaging Het
Utp20 G T 10: 88,771,960 Q1596K probably benign Het
Vmn1r28 A T 6: 58,265,540 I123F possibly damaging Het
Vmn1r73 T A 7: 11,756,669 V138E probably damaging Het
Vmn2r112 A G 17: 22,603,382 D347G probably damaging Het
Vmn2r3 T G 3: 64,259,197 T838P probably damaging Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Wdr17 T C 8: 54,629,861 D1268G probably damaging Het
Zfp108 T A 7: 24,261,314 H443Q probably damaging Het
Zfp608 A G 18: 54,946,591 V374A probably damaging Het
Zfp831 G T 2: 174,644,624 G364V probably damaging Het
Zfp94 A G 7: 24,303,741 V86A probably benign Het
Zkscan16 A C 4: 58,946,506 N127T possibly damaging Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70030088 missense probably damaging 0.98
IGL00677:Nin APN 12 70026860 missense probably damaging 1.00
IGL00823:Nin APN 12 70014793 missense probably benign 0.01
IGL01103:Nin APN 12 70056758 missense probably damaging 0.99
IGL01113:Nin APN 12 70031779 missense probably damaging 1.00
IGL01420:Nin APN 12 70045414 missense probably benign 0.08
IGL01556:Nin APN 12 70043188 missense probably benign 0.01
IGL01663:Nin APN 12 70043665 missense possibly damaging 0.72
IGL02002:Nin APN 12 70062699 nonsense probably null
IGL02030:Nin APN 12 70045268 missense probably damaging 1.00
IGL02202:Nin APN 12 70055436 missense probably damaging 1.00
IGL02207:Nin APN 12 70056657 missense probably damaging 0.99
IGL02257:Nin APN 12 70102691 missense possibly damaging 0.71
IGL02394:Nin APN 12 70044031 missense probably damaging 1.00
IGL02531:Nin APN 12 70020932 missense probably benign 0.02
IGL03028:Nin APN 12 70035270 missense probably benign 0.13
IGL03155:Nin APN 12 70031770 missense probably damaging 1.00
IGL03197:Nin APN 12 70026810 missense probably benign 0.03
IGL02835:Nin UTSW 12 70056738 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0131:Nin UTSW 12 70051141 missense probably damaging 1.00
R0132:Nin UTSW 12 70051141 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0211:Nin UTSW 12 70014875 missense probably damaging 1.00
R0734:Nin UTSW 12 70030113 missense probably benign 0.01
R0947:Nin UTSW 12 70061186 missense probably damaging 1.00
R1085:Nin UTSW 12 70020962 missense possibly damaging 0.91
R1367:Nin UTSW 12 70043929 missense probably damaging 0.99
R1452:Nin UTSW 12 70017650 nonsense probably null
R1477:Nin UTSW 12 70044184 missense possibly damaging 0.87
R1518:Nin UTSW 12 70014773 missense probably benign 0.27
R1566:Nin UTSW 12 70054479 missense probably damaging 0.99
R1572:Nin UTSW 12 70038750 missense probably damaging 1.00
R1583:Nin UTSW 12 70031738 missense probably benign
R1584:Nin UTSW 12 70042669 missense probably benign 0.03
R1699:Nin UTSW 12 70030938 missense probably benign 0.40
R1699:Nin UTSW 12 70045563 missense possibly damaging 0.87
R1765:Nin UTSW 12 70042891 missense probably damaging 1.00
R1794:Nin UTSW 12 70043795 nonsense probably null
R1952:Nin UTSW 12 70030926 missense probably damaging 1.00
R2004:Nin UTSW 12 70025477 missense probably benign 0.01
R2025:Nin UTSW 12 70030008 missense probably damaging 1.00
R2060:Nin UTSW 12 70042418 missense possibly damaging 0.64
R2213:Nin UTSW 12 70045354 missense probably damaging 1.00
R2224:Nin UTSW 12 70061230 missense probably damaging 1.00
R2247:Nin UTSW 12 70054545 missense probably damaging 1.00
R2972:Nin UTSW 12 70062713 missense probably damaging 1.00
R3776:Nin UTSW 12 70038682 missense possibly damaging 0.71
R3881:Nin UTSW 12 70042541 missense probably benign 0.00
R3930:Nin UTSW 12 70078242 missense probably damaging 1.00
R3959:Nin UTSW 12 70050752 missense probably damaging 1.00
R4229:Nin UTSW 12 70051210 missense probably damaging 0.99
R4359:Nin UTSW 12 70014938 missense probably benign 0.00
R4423:Nin UTSW 12 70042978 missense probably damaging 1.00
R4461:Nin UTSW 12 70042585 missense probably benign 0.37
R4639:Nin UTSW 12 70038601 missense probably damaging 0.97
R4791:Nin UTSW 12 70043807 missense possibly damaging 0.94
R4839:Nin UTSW 12 70090551 missense possibly damaging 0.46
R5712:Nin UTSW 12 70042769 missense probably damaging 1.00
R5726:Nin UTSW 12 70078179 missense probably damaging 1.00
R5804:Nin UTSW 12 70045601 missense possibly damaging 0.58
R5874:Nin UTSW 12 70030918 missense possibly damaging 0.94
R5992:Nin UTSW 12 70045524 missense possibly damaging 0.83
R6077:Nin UTSW 12 70019232 missense probably damaging 1.00
R6184:Nin UTSW 12 70043737 missense probably damaging 1.00
R6307:Nin UTSW 12 70014857 missense possibly damaging 0.91
R6315:Nin UTSW 12 70045615 missense probably damaging 1.00
R6326:Nin UTSW 12 70045181 missense possibly damaging 0.95
R6492:Nin UTSW 12 70054534 missense probably benign 0.22
R6562:Nin UTSW 12 70055954 missense probably damaging 1.00
R6578:Nin UTSW 12 70061194 missense probably damaging 0.99
R6613:Nin UTSW 12 70030954 missense probably damaging 1.00
R7112:Nin UTSW 12 70102799 missense
Predicted Primers PCR Primer
(F):5'- TTTCAGGTCTTGCAGCAGC -3'
(R):5'- GCAGCAGTCTCAGTAATGCTG -3'

Sequencing Primer
(F):5'- GCAGCTGCTTTCTTTCCGTG -3'
(R):5'- AGTAATGCTGTCTGTTGACCAC -3'
Posted On2016-04-15