Incidental Mutation 'R5035:Mcm3'
ID389480
Institutional Source Beutler Lab
Gene Symbol Mcm3
Ensembl Gene ENSMUSG00000041859
Gene Nameminichromosome maintenance complex component 3
SynonymsP1, p1.m, Mcmd
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20802968-20820312 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 20803418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053266]
Predicted Effect probably benign
Transcript: ENSMUST00000053266
SMART Domains Protein: ENSMUSP00000059192
Gene: ENSMUSG00000041859

DomainStartEndE-ValueType
MCM 109 654 N/A SMART
AAA 337 490 1.92e-4 SMART
coiled coil region 655 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191061
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein is a subunit of the protein complex that consists of MCM2-7. It has been shown to interact directly with MCM5/CDC46. This protein also interacts with and is acetylated by MCM3AP, a chromatin-associated acetyltransferase. The acetylation of this protein inhibits the initiation of DNA replication and cell cycle progression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null or hypomorph alleles exhibit prenatal lethality. Fetal mice homozygous for a hypomorphic allele display anemia and replicative stress during fetal erythropoiesis. Mice heterozygous for null or hypomorph alleles display increased incidence of lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Mcm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Mcm3 APN 1 20804815 critical splice donor site probably null
IGL01061:Mcm3 APN 1 20814496 missense possibly damaging 0.86
IGL01488:Mcm3 APN 1 20813056 missense possibly damaging 0.90
IGL01609:Mcm3 APN 1 20814680 splice site probably benign
IGL02483:Mcm3 APN 1 20803572 missense possibly damaging 0.68
IGL02869:Mcm3 APN 1 20808839 missense probably damaging 0.99
R0197:Mcm3 UTSW 1 20810105 missense probably damaging 1.00
R0462:Mcm3 UTSW 1 20805332 missense probably benign
R0467:Mcm3 UTSW 1 20804847 missense probably benign
R0669:Mcm3 UTSW 1 20804929 intron probably null
R1251:Mcm3 UTSW 1 20812672 nonsense probably null
R1599:Mcm3 UTSW 1 20820198 missense probably benign 0.08
R1764:Mcm3 UTSW 1 20805879 missense probably damaging 0.98
R2015:Mcm3 UTSW 1 20803580 missense probably damaging 0.98
R2140:Mcm3 UTSW 1 20813110 missense probably benign 0.00
R3033:Mcm3 UTSW 1 20808768 missense probably damaging 1.00
R4430:Mcm3 UTSW 1 20811993 nonsense probably null
R4513:Mcm3 UTSW 1 20810232 missense probably damaging 1.00
R4563:Mcm3 UTSW 1 20809645 missense probably benign
R4713:Mcm3 UTSW 1 20803577 missense probably benign
R4801:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4802:Mcm3 UTSW 1 20810156 missense probably damaging 0.99
R4896:Mcm3 UTSW 1 20820256 utr 5 prime probably benign
R5461:Mcm3 UTSW 1 20814437 missense probably benign 0.00
R5486:Mcm3 UTSW 1 20814894 missense probably damaging 1.00
R5531:Mcm3 UTSW 1 20803544 missense possibly damaging 0.46
R5759:Mcm3 UTSW 1 20808748 frame shift probably null
R5760:Mcm3 UTSW 1 20808748 frame shift probably null
R6505:Mcm3 UTSW 1 20803544 missense probably damaging 1.00
R6833:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R6834:Mcm3 UTSW 1 20810096 missense possibly damaging 0.48
R7179:Mcm3 UTSW 1 20814857 missense probably damaging 0.98
X0062:Mcm3 UTSW 1 20820137 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AAGACTCCCCATGTTTAGGACTG -3'
(R):5'- TTTTAAGGCGGCCCTCTTAG -3'

Sequencing Primer
(F):5'- CCATGTTTAGGACTGGGGCTTG -3'
(R):5'- CCCTCTTAGAAGTGTTCCAGGAAG -3'
Posted On2016-06-06