Incidental Mutation 'R5234:Atp1a4'
ID398178
Institutional Source Beutler Lab
Gene Symbol Atp1a4
Ensembl Gene ENSMUSG00000007107
Gene NameATPase, Na+/K+ transporting, alpha 4 polypeptide
Synonyms
MMRRC Submission 042806-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5234 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172223513-172258414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 172227170 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 964 (I964K)
Ref Sequence ENSEMBL: ENSMUSP00000106874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111243]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111243
AA Change: I964K

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: I964K

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,263,664 T2132M probably damaging Het
Abca8b A T 11: 109,976,594 F213I possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adamts6 A G 13: 104,493,622 Y1091C probably damaging Het
Adamtsl4 T C 3: 95,680,920 M586V probably benign Het
Anapc4 T C 5: 52,848,776 S336P probably damaging Het
Bcan A T 3: 87,996,146 D246E probably damaging Het
Ccnf G A 17: 24,234,437 R343* probably null Het
Col6a5 T C 9: 105,864,205 H2505R probably damaging Het
Dlg5 T A 14: 24,192,862 M72L probably damaging Het
Dnajc18 T C 18: 35,683,298 T196A probably benign Het
Dnajc19 T A 3: 34,057,959 I146F probably benign Het
Espnl A G 1: 91,344,793 D581G probably benign Het
Fam167a T C 14: 63,452,338 L28P probably damaging Het
Fam71d T A 12: 78,715,271 Y236* probably null Het
Fra10ac1 T C 19: 38,215,846 D94G probably damaging Het
Fut8 A G 12: 77,332,230 H35R probably benign Het
Gad1-ps T A 10: 99,445,326 noncoding transcript Het
Idh2 A T 7: 80,096,105 V333E probably damaging Het
Inpp5f A G 7: 128,663,683 I121V probably benign Het
Itga1 A T 13: 115,049,303 Y54* probably null Het
Lax1 A G 1: 133,680,583 V140A probably benign Het
Ncoa6 A G 2: 155,438,013 F28L probably benign Het
Olfr1145 T C 2: 87,810,768 V316A probably benign Het
Olfr357 T C 2: 36,997,095 V95A probably benign Het
Polr2a T C 11: 69,736,840 I1414V probably benign Het
Ppp1r14b A G 19: 6,976,859 E115G possibly damaging Het
Prune2 A G 19: 17,118,668 D512G probably damaging Het
Psmd11 A G 11: 80,428,740 I19V probably benign Het
Pthlh C A 6: 147,257,094 G123W probably damaging Het
Qars T A 9: 108,514,165 L572Q probably damaging Het
Rubcn T C 16: 32,836,458 I516V probably damaging Het
Sgsm3 A T 15: 81,007,944 S238C probably damaging Het
Slc25a22 C A 7: 141,434,203 probably benign Het
Slc4a1 G A 11: 102,361,383 R5W probably benign Het
Tie1 G A 4: 118,482,762 T356I probably benign Het
Tnn A T 1: 160,144,999 H344Q possibly damaging Het
Tnrc6c G T 11: 117,760,729 V1693F probably benign Het
Topaz1 C T 9: 122,790,193 T1285M possibly damaging Het
Trank1 A T 9: 111,386,467 S1822C probably damaging Het
Ttll11 A C 2: 35,940,733 Y209D probably damaging Het
Unc45a C G 7: 80,328,799 A634P probably benign Het
Vmn2r4 C T 3: 64,398,457 V515I possibly damaging Het
Other mutations in Atp1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Atp1a4 APN 1 172239806 missense probably damaging 1.00
IGL00924:Atp1a4 APN 1 172246772 missense probably damaging 1.00
IGL01288:Atp1a4 APN 1 172257907 missense possibly damaging 0.77
IGL01665:Atp1a4 APN 1 172246724 missense probably benign
IGL02156:Atp1a4 APN 1 172257962 missense probably benign
IGL02170:Atp1a4 APN 1 172234536 missense possibly damaging 0.94
IGL02228:Atp1a4 APN 1 172254885 missense possibly damaging 0.69
IGL02505:Atp1a4 APN 1 172235075 missense probably damaging 1.00
IGL02653:Atp1a4 APN 1 172251406 missense possibly damaging 0.81
IGL02792:Atp1a4 APN 1 172227299 critical splice donor site probably null
IGL02794:Atp1a4 APN 1 172244086 missense probably benign 0.13
IGL03102:Atp1a4 APN 1 172231151 missense probably damaging 1.00
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0046:Atp1a4 UTSW 1 172240097 missense probably benign 0.09
R0276:Atp1a4 UTSW 1 172257901 missense probably damaging 1.00
R0309:Atp1a4 UTSW 1 172234987 missense probably damaging 1.00
R0525:Atp1a4 UTSW 1 172239688 splice site probably benign
R0615:Atp1a4 UTSW 1 172232060 splice site probably benign
R0730:Atp1a4 UTSW 1 172240207 splice site probably benign
R1412:Atp1a4 UTSW 1 172232009 missense probably damaging 0.97
R1652:Atp1a4 UTSW 1 172254903 missense probably damaging 1.00
R1898:Atp1a4 UTSW 1 172235048 missense probably damaging 0.99
R1968:Atp1a4 UTSW 1 172240164 missense probably benign
R2291:Atp1a4 UTSW 1 172244906 missense probably damaging 1.00
R2897:Atp1a4 UTSW 1 172246690 missense probably damaging 1.00
R2908:Atp1a4 UTSW 1 172234477 missense probably benign
R3119:Atp1a4 UTSW 1 172239826 missense probably damaging 0.99
R3731:Atp1a4 UTSW 1 172233961 missense probably damaging 1.00
R4447:Atp1a4 UTSW 1 172234431 missense probably damaging 0.99
R4602:Atp1a4 UTSW 1 172239765 missense probably damaging 1.00
R4670:Atp1a4 UTSW 1 172235000 missense probably benign 0.07
R4674:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4675:Atp1a4 UTSW 1 172257656 missense possibly damaging 0.81
R4785:Atp1a4 UTSW 1 172254110 nonsense probably null
R4958:Atp1a4 UTSW 1 172231151 missense probably damaging 1.00
R5015:Atp1a4 UTSW 1 172254082 missense probably damaging 1.00
R5149:Atp1a4 UTSW 1 172232005 missense probably damaging 1.00
R5501:Atp1a4 UTSW 1 172246832 missense probably damaging 1.00
R5682:Atp1a4 UTSW 1 172254163 missense probably damaging 0.99
R5872:Atp1a4 UTSW 1 172244408 missense probably damaging 1.00
R5933:Atp1a4 UTSW 1 172232274 missense possibly damaging 0.91
R6722:Atp1a4 UTSW 1 172258050 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAGCTTGTGATCTCCTGAC -3'
(R):5'- TCATCATCTGCAAGACACGC -3'

Sequencing Primer
(F):5'- TGACATAGTCTCCGATACCGC -3'
(R):5'- GCAGAAATTCACTCTTCAAGCAGGG -3'
Posted On2016-07-06