Incidental Mutation 'R5260:Olfr1302'
ID401351
Institutional Source Beutler Lab
Gene Symbol Olfr1302
Ensembl Gene ENSMUSG00000044560
Gene Nameolfactory receptor 1302
SynonymsMOR248-3, GA_x6K02T2Q125-72831562-72832500
MMRRC Submission 042829-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5260 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111777429-111782700 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111781181 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 287 (Y287C)
Ref Sequence ENSEMBL: ENSMUSP00000150896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054004] [ENSMUST00000119566] [ENSMUST00000214708] [ENSMUST00000215244]
Predicted Effect probably damaging
Transcript: ENSMUST00000054004
AA Change: Y290C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061674
Gene: ENSMUSG00000044560
AA Change: Y290C

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 2.4e-49 PFAM
Pfam:7tm_1 44 290 8.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119566
AA Change: Y287C
Predicted Effect probably damaging
Transcript: ENSMUST00000214708
AA Change: Y287C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215244
AA Change: Y287C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik A T 1: 93,159,978 V51E probably damaging Het
Abraxas2 A T 7: 132,859,274 I14F probably damaging Het
Acin1 T C 14: 54,642,822 probably benign Het
Adamts9 C A 6: 92,807,137 V1579L probably benign Het
Adra2a T A 19: 54,046,608 C132S probably damaging Het
Aif1 T A 17: 35,171,941 probably null Het
Atf5 A T 7: 44,815,086 Y27* probably null Het
Atm A G 9: 53,506,611 S799P probably damaging Het
Bmp2k T G 5: 97,087,351 probably benign Het
Chaf1a C T 17: 56,065,000 H723Y probably damaging Het
Clint1 T C 11: 45,907,942 W493R probably damaging Het
Cyb561a3 T A 19: 10,587,866 V198D possibly damaging Het
Cyp2j8 T C 4: 96,501,064 E174G possibly damaging Het
Cyp4v3 C T 8: 45,306,980 G512S probably damaging Het
Dnah8 T A 17: 30,700,419 V1122D probably benign Het
Doc2b C A 11: 75,786,163 G128V probably damaging Het
Dysf T C 6: 84,150,034 V1378A probably damaging Het
Efcab5 A T 11: 77,137,651 S421T possibly damaging Het
Efcab6 T G 15: 83,945,123 D672A probably benign Het
Eif2ak3 C A 6: 70,893,129 H933Q probably damaging Het
Erc1 A T 6: 119,761,159 N574K probably damaging Het
Eri2 A T 7: 119,787,846 probably benign Het
Faxc A G 4: 21,948,744 Y152C probably damaging Het
Fbxl7 T A 15: 26,543,499 Y354F probably damaging Het
Fras1 T A 5: 96,735,187 I2526N possibly damaging Het
Gm1966 A G 7: 106,599,204 noncoding transcript Het
Gm5424 A T 10: 62,071,595 noncoding transcript Het
Gm6728 T C 6: 136,486,703 noncoding transcript Het
Golgb1 A T 16: 36,913,141 S917C probably benign Het
Gtpbp3 T C 8: 71,489,418 probably benign Het
Gusb A T 5: 129,999,988 Y220* probably null Het
Hmcn1 A G 1: 150,595,861 V4914A possibly damaging Het
Iars2 C A 1: 185,323,734 C211F probably damaging Het
Kif5b A G 18: 6,211,058 L802P probably damaging Het
Kif5c A G 2: 49,735,590 E624G probably damaging Het
Kmt2d G T 15: 98,842,860 probably benign Het
Krt82 C A 15: 101,548,388 G186C possibly damaging Het
Lca5 G A 9: 83,423,223 R177C probably damaging Het
Mier1 T C 4: 103,162,710 S318P probably benign Het
Obscn A T 11: 59,003,369 I1207N probably damaging Het
Olfr1161 A C 2: 88,025,474 I251L probably benign Het
Olfr1261 A G 2: 89,994,182 D263G probably damaging Het
Olfr607 A G 7: 103,460,615 F198L probably benign Het
Oog4 C T 4: 143,437,854 G369D probably benign Het
Plec T C 15: 76,176,624 T3060A probably damaging Het
Plekhh2 C T 17: 84,577,165 T769I probably damaging Het
Prkaa1 A T 15: 5,160,668 S65C probably damaging Het
Psma3 T C 12: 70,984,642 probably benign Het
Ptpn18 T A 1: 34,463,510 probably benign Het
Ptprv T C 1: 135,112,260 noncoding transcript Het
Rac1 C A 5: 143,508,131 V104L probably benign Het
Serpinb7 A T 1: 107,434,749 N61I possibly damaging Het
Sirt7 A C 11: 120,620,521 probably benign Het
Srl G A 16: 4,482,895 R333* probably null Het
Srprb A T 9: 103,201,920 L756Q probably damaging Het
Tchhl1 T C 3: 93,470,795 S269P probably damaging Het
Tdo2 C T 3: 81,975,323 probably null Het
Teddm1a T C 1: 153,891,900 Y37H probably benign Het
Tenm3 T C 8: 48,236,855 Y1899C probably damaging Het
Tep1 T C 14: 50,838,631 T1681A probably benign Het
Timm44 G T 8: 4,275,919 probably null Het
Trp73 A G 4: 154,062,602 V322A possibly damaging Het
Tsr1 A C 11: 74,905,955 E611A probably damaging Het
Unc80 A G 1: 66,646,587 N2290S possibly damaging Het
Ush2a T C 1: 188,947,079 V4828A possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt9b C A 11: 103,732,049 S176I possibly damaging Het
Zfp329 A G 7: 12,806,526 probably benign Het
Zfp352 T A 4: 90,224,460 V279D probably damaging Het
Zfp932 C T 5: 110,009,635 Q400* probably null Het
Zxdc T A 6: 90,382,093 L569Q probably damaging Het
Other mutations in Olfr1302
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Olfr1302 APN 2 111780901 missense possibly damaging 0.80
IGL01604:Olfr1302 APN 2 111780590 missense possibly damaging 0.60
IGL02959:Olfr1302 APN 2 111780610 missense probably damaging 1.00
IGL02975:Olfr1302 APN 2 111780921 nonsense probably null
IGL03357:Olfr1302 APN 2 111780526 missense probably benign 0.01
R0245:Olfr1302 UTSW 2 111780335 missense probably damaging 1.00
R1522:Olfr1302 UTSW 2 111780348 synonymous probably null
R2126:Olfr1302 UTSW 2 111780496 missense probably damaging 0.99
R2432:Olfr1302 UTSW 2 111780671 missense probably benign 0.01
R4780:Olfr1302 UTSW 2 111780845 missense probably damaging 1.00
R5517:Olfr1302 UTSW 2 111780459 missense probably benign
R6273:Olfr1302 UTSW 2 111781222 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGGCTGGGGCATCTAAGG -3'
(R):5'- TAAATCAGAATGTTGTGGTGGC -3'

Sequencing Primer
(F):5'- ATCTAAGGCCCTGTCCACGTG -3'
(R):5'- CCTATATCTGAAATGGGAGGTGGC -3'
Posted On2016-07-06