Incidental Mutation 'R5077:Rbck1'
ID401923
Institutional Source Beutler Lab
Gene Symbol Rbck1
Ensembl Gene ENSMUSG00000027466
Gene NameRanBP-type and C3HC4-type zinc finger containing 1
SynonymsHOIL-1, HOIL-1L, Ubce7ip3
MMRRC Submission 042666-MU
Accession Numbers

Genbank: NM_001083921; MGI: 1344372

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5077 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152316334-152332653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 152318451 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 436 (M436R)
Ref Sequence ENSEMBL: ENSMUSP00000105473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028963] [ENSMUST00000028964] [ENSMUST00000109847]
Predicted Effect probably benign
Transcript: ENSMUST00000028963
SMART Domains Protein: ENSMUSP00000028963
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
TBC 56 268 6.19e-5 SMART
low complexity region 304 323 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028964
AA Change: M436R

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466
AA Change: M436R

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109847
AA Change: M436R

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466
AA Change: M436R

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140482
Predicted Effect probably benign
Transcript: ENSMUST00000144865
SMART Domains Protein: ENSMUSP00000118592
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
coiled coil region 13 41 N/A INTRINSIC
RING 63 107 2.67e-5 SMART
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145889
Meta Mutation Damage Score 0.0536 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased TNF-induced hepatocyte apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,326,030 S191R probably benign Het
Agbl4 A T 4: 111,566,742 M322L probably benign Het
Ankrd55 A G 13: 112,355,988 K231R probably benign Het
Asap1 A C 15: 64,127,423 M534R probably damaging Het
B4galnt2 T A 11: 95,876,314 probably benign Het
Cacna1e A T 1: 154,561,729 probably null Het
Cacna1h T C 17: 25,375,250 I2311M probably benign Het
Capn2 G T 1: 182,472,573 D617E possibly damaging Het
Catsper1 A G 19: 5,335,970 D77G probably damaging Het
Cdc42bpa A T 1: 180,094,533 probably benign Het
Cdca8 T C 4: 124,926,677 K109E probably damaging Het
Dbx1 A G 7: 49,633,494 S223P probably damaging Het
Dlg4 A G 11: 70,027,026 N45S possibly damaging Het
Dlgap2 T G 8: 14,822,691 V723G probably benign Het
Efl1 C A 7: 82,658,087 Q64K probably damaging Het
Eml1 T A 12: 108,506,612 probably benign Het
Fam129a A G 1: 151,714,523 I523V probably benign Het
Fbxw16 A G 9: 109,441,049 probably null Het
Gm10800 A T 2: 98,667,034 L80M probably benign Het
Gm5346 A G 8: 43,627,163 V8A possibly damaging Het
Hist4h4 A G 6: 136,804,115 Y89H probably benign Het
Insig2 A T 1: 121,312,235 V112E probably damaging Het
Kcnip3 A G 2: 127,465,877 S123P probably damaging Het
Map3k9 T C 12: 81,734,077 probably null Het
Myo16 T C 8: 10,322,658 V119A probably damaging Het
Naa25 G A 5: 121,424,576 V474M probably benign Het
Nckap1 A T 2: 80,548,933 V219E probably damaging Het
Nrp1 G T 8: 128,500,673 probably null Het
Nsun4 A T 4: 116,048,584 D58E probably benign Het
Obscn G T 11: 59,044,057 A5249D probably damaging Het
Olfr1055 A T 2: 86,347,339 H142Q probably benign Het
Osmr A T 15: 6,844,393 Y174* probably null Het
Pi4k2a T C 19: 42,119,836 probably null Het
Pram1 C T 17: 33,644,904 Q572* probably null Het
Prdm5 C A 6: 65,779,174 T25K probably damaging Het
Psen1 T C 12: 83,724,665 Y240H probably damaging Het
Pygl C T 12: 70,201,892 G318S probably benign Het
Rmnd1 T C 10: 4,427,488 N64D possibly damaging Het
Rsph4a A G 10: 33,908,279 D299G probably damaging Het
Sema4c T C 1: 36,551,731 S480G probably benign Het
Srp68 T C 11: 116,245,812 D552G probably damaging Het
Syde2 G T 3: 146,002,009 A568S probably damaging Het
Szrd1 G T 4: 141,139,781 probably null Het
Szt2 A T 4: 118,369,616 probably null Het
Tbc1d31 A G 15: 57,955,401 E800G probably benign Het
Tmprss11d C A 5: 86,309,263 probably null Het
Usp37 A G 1: 74,441,561 V895A probably damaging Het
Vmn1r19 T C 6: 57,405,041 I193T probably benign Het
Vmn2r102 T C 17: 19,677,572 V283A probably benign Het
Vps13d C T 4: 145,088,241 G3180D probably damaging Het
Xirp2 A C 2: 67,514,477 D2354A probably benign Het
Zc3h14 T A 12: 98,757,206 probably null Het
Other mutations in Rbck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Rbck1 APN 2 152318395 missense probably damaging 0.98
IGL00765:Rbck1 APN 2 152330954 splice site probably benign
IGL01647:Rbck1 APN 2 152323232 missense probably damaging 1.00
IGL01945:Rbck1 APN 2 152318316 missense probably damaging 1.00
IGL02141:Rbck1 APN 2 152318374 missense possibly damaging 0.56
IGL02573:Rbck1 APN 2 152322167 missense possibly damaging 0.90
IGL02950:Rbck1 APN 2 152331077 missense possibly damaging 0.95
green_fire UTSW 2 152323174 nonsense probably null
iron_throne UTSW 2 152318451 missense probably benign 0.45
viserion UTSW 2 152330966 missense possibly damaging 0.87
westeros UTSW 2 152318733 nonsense probably null
A4554:Rbck1 UTSW 2 152319172 missense probably damaging 1.00
R0532:Rbck1 UTSW 2 152324330 missense probably damaging 0.99
R1426:Rbck1 UTSW 2 152327241 unclassified probably benign
R1598:Rbck1 UTSW 2 152323170 critical splice donor site probably null
R1666:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1668:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1889:Rbck1 UTSW 2 152318356 missense probably damaging 0.99
R4572:Rbck1 UTSW 2 152318733 nonsense probably null
R4592:Rbck1 UTSW 2 152318733 nonsense probably null
R6049:Rbck1 UTSW 2 152323174 nonsense probably null
R6494:Rbck1 UTSW 2 152330966 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGAAGTACTGAGTCCCACTCC -3'
(R):5'- TTGGAGGCCAAGACTTCCTC -3'

Sequencing Primer
(F):5'- GAAGTACTGAGTCCCACTCCAGTTAC -3'
(R):5'- AGACTTCCTCCTGGTCAAACC -3'
Posted On2016-07-22