Incidental Mutation 'R0465:Map3k19'
ID41549
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Namemitogen-activated protein kinase kinase kinase 19
SynonymsYsk4
MMRRC Submission 038665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R0465 (G1)
Quality Score195
Status Validated
Chromosome1
Chromosomal Location127815253-127855031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127838527 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 220 (D220G)
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
Predicted Effect probably damaging
Transcript: ENSMUST00000061512
AA Change: D16G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: D16G

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187653
AA Change: D26G
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: D26G

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect unknown
Transcript: ENSMUST00000189398
AA Change: D26G
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590
AA Change: D26G

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000191333
AA Change: D26G
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590
AA Change: D26G

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208183
AA Change: D220G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030411F24Rik A G 2: 148,783,425 N93S probably benign Het
Adgre4 T A 17: 55,785,137 probably benign Het
Ankrd13a T A 5: 114,804,234 I526N probably damaging Het
Aox1 G A 1: 58,062,207 V446I probably damaging Het
Arid1b G A 17: 4,996,260 G441D possibly damaging Het
BC027072 A G 17: 71,750,160 C841R probably benign Het
Bdkrb2 A T 12: 105,591,859 N120Y possibly damaging Het
Bud31 G A 5: 145,146,586 V80I probably damaging Het
Camkmt T A 17: 85,431,522 F225L probably damaging Het
Carf T C 1: 60,131,983 M200T probably damaging Het
Carmil3 T C 14: 55,499,861 L767P probably damaging Het
Cdk14 T A 5: 5,093,019 R237S probably damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cfap65 G A 1: 74,916,884 R1093C possibly damaging Het
Cnot8 T A 11: 58,114,060 V195E probably damaging Het
Copa T C 1: 172,118,305 F936S probably damaging Het
Dnaic1 T A 4: 41,629,988 probably null Het
Dsel T C 1: 111,862,262 N181S probably benign Het
Enpp7 A G 11: 118,988,781 N87S probably damaging Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gm12695 T C 4: 96,785,075 Y29C probably damaging Het
Gm5592 T A 7: 41,156,057 probably benign Het
Gmnc T G 16: 26,962,952 N109T probably damaging Het
Gstcd A G 3: 132,983,144 I615T probably benign Het
Hal A C 10: 93,516,284 K646Q probably benign Het
Hbs1l A G 10: 21,352,041 I472V probably null Het
Ift27 A T 15: 78,173,758 probably benign Het
Iqub A T 6: 24,503,784 I163N probably damaging Het
Isg20l2 T A 3: 87,931,680 V66E probably benign Het
Itgb4 T C 11: 115,979,756 M137T probably damaging Het
Lca5 T A 9: 83,395,867 K475* probably null Het
Lyve1 A G 7: 110,852,827 probably null Het
Mdn1 T A 4: 32,699,204 probably benign Het
Mmp15 T C 8: 95,367,998 W167R probably damaging Het
Ms4a13 A G 19: 11,172,593 C135R probably benign Het
Myh1 A G 11: 67,210,417 H673R possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Oas2 A G 5: 120,735,055 I645T probably damaging Het
Olfr605 A T 7: 103,442,835 F96Y possibly damaging Het
Pard3b T G 1: 62,211,718 probably benign Het
Patj T A 4: 98,535,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Rab34 C A 11: 78,190,511 C67* probably null Het
Rimbp3 T C 16: 17,211,780 S1023P possibly damaging Het
Rnf148 T C 6: 23,654,685 N104S probably benign Het
Rpa1 T C 11: 75,313,095 T288A probably damaging Het
Scn9a A G 2: 66,526,996 L976P probably damaging Het
Serpina12 T A 12: 104,037,845 D176V probably benign Het
Sik1 C T 17: 31,855,022 V10I possibly damaging Het
Sntb1 C A 15: 55,749,276 R302L probably benign Het
Stambp A G 6: 83,570,339 I56T probably benign Het
Tac2 A G 10: 127,729,170 probably benign Het
Tecta A T 9: 42,359,418 I1198K possibly damaging Het
Tfip11 C T 5: 112,333,264 R369C probably benign Het
Tnpo1 A G 13: 98,884,634 I79T probably damaging Het
Ttll5 A T 12: 85,933,326 N895Y probably benign Het
Ube2u T A 4: 100,532,096 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r1 T C 3: 64,081,759 S40P possibly damaging Het
Vmn2r100 G A 17: 19,531,530 V612I probably damaging Het
Vmn2r59 G T 7: 42,046,908 H137N probably benign Het
Vsig10l T C 7: 43,467,442 V467A probably damaging Het
Vwde A G 6: 13,215,806 probably benign Het
Xrra1 T A 7: 99,879,371 D139E probably benign Het
Zc3h15 T C 2: 83,663,815 probably benign Het
Zfhx4 C T 3: 5,245,656 probably benign Het
Zscan18 A G 7: 12,775,486 probably benign Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127824331 nonsense probably null
IGL01367:Map3k19 APN 1 127824351 missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127838507 missense probably benign 0.38
IGL01481:Map3k19 APN 1 127822478 missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127822104 missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127830273 missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127823505 missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127823170 missense probably benign 0.00
IGL02296:Map3k19 APN 1 127824246 missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127823769 missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127822264 missense probably benign 0.01
IGL02965:Map3k19 APN 1 127824066 missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127824315 missense probably benign 0.04
R0125:Map3k19 UTSW 1 127823100 missense probably benign 0.07
R0265:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0443:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0645:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127817425 missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127834638 splice site probably benign
R0838:Map3k19 UTSW 1 127823959 missense probably benign 0.13
R1173:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1174:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1175:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1457:Map3k19 UTSW 1 127817898 missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127822680 missense probably benign 0.02
R1944:Map3k19 UTSW 1 127823122 missense probably benign 0.29
R2496:Map3k19 UTSW 1 127823086 missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127823793 missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127822098 missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127838553 critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127822813 nonsense probably null
R4612:Map3k19 UTSW 1 127815300 missense probably benign 0.07
R4888:Map3k19 UTSW 1 127817733 missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127822195 missense probably benign 0.08
R5028:Map3k19 UTSW 1 127823232 missense probably benign 0.00
R5050:Map3k19 UTSW 1 127823562 missense probably benign 0.21
R5131:Map3k19 UTSW 1 127823690 missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127834547 nonsense probably null
R5606:Map3k19 UTSW 1 127822957 missense probably benign
R5617:Map3k19 UTSW 1 127822966 missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127822381 missense probably benign 0.02
R5854:Map3k19 UTSW 1 127830355 missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127822740 missense probably benign 0.01
R6132:Map3k19 UTSW 1 127850476 missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127822832 missense probably benign 0.05
R6261:Map3k19 UTSW 1 127822599 missense possibly damaging 0.95
R6471:Map3k19 UTSW 1 127817254 missense probably damaging 1.00
R6726:Map3k19 UTSW 1 127820448 missense probably benign 0.09
R6732:Map3k19 UTSW 1 127824232 missense probably benign 0.37
R6762:Map3k19 UTSW 1 127847264 missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127817455 missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127838452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGATGGGGTGTTACATACTATGGGA -3'
(R):5'- CCTGTTGATGACTCAGAGGGTTGAAAA -3'

Sequencing Primer
(F):5'- agaaaagggtatggagttatggg -3'
(R):5'- GTGTGGTGCATGTACATGCAT -3'
Posted On2013-05-23