Incidental Mutation 'R6471:Map3k19'
ID516686
Institutional Source Beutler Lab
Gene Symbol Map3k19
Ensembl Gene ENSMUSG00000051590
Gene Namemitogen-activated protein kinase kinase kinase 19
SynonymsYsk4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6471 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location127815253-127855031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127817254 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1488 (V1488M)
Ref Sequence ENSEMBL: ENSMUSP00000146463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061512] [ENSMUST00000208183]
Predicted Effect probably damaging
Transcript: ENSMUST00000061512
AA Change: V1284M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056254
Gene: ENSMUSG00000051590
AA Change: V1284M

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 232 248 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
S_TKc 1044 1307 3.18e-90 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187653
AA Change: V1183M
SMART Domains Protein: ENSMUSP00000140930
Gene: ENSMUSG00000051590
AA Change: V1183M

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
low complexity region 121 137 N/A INTRINSIC
low complexity region 841 853 N/A INTRINSIC
S_TKc 933 1196 1.5e-92 SMART
Predicted Effect unknown
Transcript: ENSMUST00000189398
AA Change: V439M
SMART Domains Protein: ENSMUSP00000140449
Gene: ENSMUSG00000051590
AA Change: V439M

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 216 452 4.8e-15 SMART
Predicted Effect unknown
Transcript: ENSMUST00000191333
AA Change: V487M
SMART Domains Protein: ENSMUSP00000141029
Gene: ENSMUSG00000051590
AA Change: V487M

DomainStartEndE-ValueType
low complexity region 42 54 N/A INTRINSIC
S_TKc 237 500 1.5e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208183
AA Change: V1488M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.6%
Validation Efficiency 97% (29/30)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Birc3 A G 9: 7,857,420 S351P probably benign Het
Car9 T C 4: 43,511,938 V319A probably damaging Het
Ccdc86 A G 19: 10,948,879 S119P unknown Het
Cideb T C 14: 55,757,952 R26G probably benign Het
Clip1 A G 5: 123,640,549 V437A probably damaging Het
Cobll1 A G 2: 65,107,884 S352P probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Exoc3l A G 8: 105,290,534 V607A probably damaging Het
Fam227b A T 2: 126,121,065 V177D probably damaging Het
Fam96a T A 9: 66,126,857 V4E possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Gdap1 T A 1: 17,160,025 N227K possibly damaging Het
Glod4 A T 11: 76,233,918 F185L probably damaging Het
Gm884 T A 11: 103,619,622 probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Pak7 A T 2: 136,116,190 M326K probably benign Het
Peak1 A G 9: 56,258,259 L795P probably damaging Het
Plcg1 A G 2: 160,753,710 D526G probably benign Het
Rapgef6 A G 11: 54,691,737 I1492V probably damaging Het
Rbfa G T 18: 80,200,458 S31* probably null Het
Rnft1 T C 11: 86,491,682 Y244H possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,914 probably benign Het
Slc6a3 G A 13: 73,544,884 G208R probably benign Het
Tex15 G T 8: 33,581,734 Q2436H probably damaging Het
Ttbk1 A G 17: 46,467,277 L613P probably benign Het
Tuba1b T C 15: 98,932,447 K164R probably benign Het
Usp9y A G Y: 1,384,511 L669P probably damaging Homo
Vmn1r169 A G 7: 23,577,545 T121A probably benign Het
Vmn2r51 A C 7: 10,102,583 D90E possibly damaging Het
Zfp318 A G 17: 46,399,505 H718R probably benign Het
Zfp93 T C 7: 24,273,329 Y33H probably damaging Het
Other mutations in Map3k19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01126:Map3k19 APN 1 127824331 nonsense probably null
IGL01367:Map3k19 APN 1 127824351 missense possibly damaging 0.88
IGL01443:Map3k19 APN 1 127838507 missense probably benign 0.38
IGL01481:Map3k19 APN 1 127822478 missense probably damaging 0.99
IGL01530:Map3k19 APN 1 127822104 missense probably damaging 1.00
IGL01603:Map3k19 APN 1 127830273 missense possibly damaging 0.89
IGL02044:Map3k19 APN 1 127823505 missense probably damaging 1.00
IGL02159:Map3k19 APN 1 127823170 missense probably benign 0.00
IGL02296:Map3k19 APN 1 127824246 missense probably damaging 1.00
IGL02349:Map3k19 APN 1 127823769 missense possibly damaging 0.48
IGL02823:Map3k19 APN 1 127822264 missense probably benign 0.01
IGL02965:Map3k19 APN 1 127824066 missense probably damaging 0.98
IGL03137:Map3k19 APN 1 127824315 missense probably benign 0.04
R0125:Map3k19 UTSW 1 127823100 missense probably benign 0.07
R0265:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0389:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0443:Map3k19 UTSW 1 127822415 missense probably benign 0.08
R0465:Map3k19 UTSW 1 127838527 missense probably damaging 1.00
R0645:Map3k19 UTSW 1 127822182 missense possibly damaging 0.61
R0759:Map3k19 UTSW 1 127817425 missense possibly damaging 0.90
R0815:Map3k19 UTSW 1 127834638 splice site probably benign
R0838:Map3k19 UTSW 1 127823959 missense probably benign 0.13
R1173:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1174:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1175:Map3k19 UTSW 1 127823880 missense probably benign 0.17
R1457:Map3k19 UTSW 1 127817898 missense probably damaging 1.00
R1661:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1665:Map3k19 UTSW 1 127817656 missense possibly damaging 0.95
R1753:Map3k19 UTSW 1 127822680 missense probably benign 0.02
R1944:Map3k19 UTSW 1 127823122 missense probably benign 0.29
R2496:Map3k19 UTSW 1 127823086 missense probably damaging 1.00
R2878:Map3k19 UTSW 1 127823793 missense possibly damaging 0.61
R2895:Map3k19 UTSW 1 127822098 missense possibly damaging 0.60
R3025:Map3k19 UTSW 1 127838553 critical splice acceptor site probably null
R4577:Map3k19 UTSW 1 127822813 nonsense probably null
R4612:Map3k19 UTSW 1 127815300 missense probably benign 0.07
R4888:Map3k19 UTSW 1 127817733 missense probably damaging 1.00
R4927:Map3k19 UTSW 1 127822195 missense probably benign 0.08
R5028:Map3k19 UTSW 1 127823232 missense probably benign 0.00
R5050:Map3k19 UTSW 1 127823562 missense probably benign 0.21
R5131:Map3k19 UTSW 1 127823690 missense possibly damaging 0.78
R5556:Map3k19 UTSW 1 127834547 nonsense probably null
R5606:Map3k19 UTSW 1 127822957 missense probably benign
R5617:Map3k19 UTSW 1 127822966 missense probably damaging 1.00
R5755:Map3k19 UTSW 1 127822381 missense probably benign 0.02
R5854:Map3k19 UTSW 1 127830355 missense probably damaging 0.96
R5952:Map3k19 UTSW 1 127822740 missense probably benign 0.01
R6132:Map3k19 UTSW 1 127850476 missense possibly damaging 0.53
R6175:Map3k19 UTSW 1 127822832 missense probably benign 0.05
R6261:Map3k19 UTSW 1 127822599 missense possibly damaging 0.95
R6726:Map3k19 UTSW 1 127820448 missense probably benign 0.09
R6732:Map3k19 UTSW 1 127824232 missense probably benign 0.37
R6762:Map3k19 UTSW 1 127847264 missense probably damaging 1.00
R7366:Map3k19 UTSW 1 127817455 missense probably damaging 1.00
R7414:Map3k19 UTSW 1 127838452 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAAGTGGGTATTTATACTCTTTGGG -3'
(R):5'- TGAGTCTGGCTATGGAAGGA -3'

Sequencing Primer
(F):5'- TGCTGAAGCTACAGGCATCTAGC -3'
(R):5'- AAATCAGATATATGGAGCATTGGC -3'
Posted On2018-05-21