Incidental Mutation 'R5424:Actb'
ID426753
Institutional Source Beutler Lab
Gene Symbol Actb
Ensembl Gene ENSMUSG00000029580
Gene Nameactin, beta
SynonymsActx, A-X actin-like protein, E430023M04Rik, beta-actin
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142903115-142906754 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 142905551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100497] [ENSMUST00000106216] [ENSMUST00000163829] [ENSMUST00000167721] [ENSMUST00000171419]
Predicted Effect probably benign
Transcript: ENSMUST00000100497
SMART Domains Protein: ENSMUSP00000098066
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 5 375 1.67e-243 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106216
SMART Domains Protein: ENSMUSP00000101823
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 8 150 8.66e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163829
SMART Domains Protein: ENSMUSP00000132135
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
Pfam:Actin 2 58 8.5e-18 PFAM
Pfam:Actin 52 108 6.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167386
Predicted Effect probably benign
Transcript: ENSMUST00000167721
SMART Domains Protein: ENSMUSP00000127663
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 5 295 1.84e-149 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171419
SMART Domains Protein: ENSMUSP00000130611
Gene: ENSMUSG00000029580

DomainStartEndE-ValueType
ACTIN 5 265 3.43e-117 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196997
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the actin family of proteins. Actins are highly conserved proteins that are among the most abundant proteins in eukaryotic cells and are involved in cell motility, structure, and integrity. Localization, stability, and translation of the transcribed mRNA are regulated through the binding of multiple factors to its 3' UTR sequence. Homozygous knockout mice for this gene exhibit embryonic lethality. Numerous pseudogenes of this gene have been identified in the mouse genome. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Homozygotes for a hypomorphic targeted mutation develop normally until embryonic day 8.5; are growth retarded by day 9.5 and die shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Actb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Actb APN 5 142904436 missense probably damaging 0.97
R1612:Actb UTSW 5 142905595 missense probably damaging 1.00
R4872:Actb UTSW 5 142905552 splice site probably benign
R5305:Actb UTSW 5 142904230 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACACGCAGCTCATTGTAGAAG -3'
(R):5'- CGAGGTGACTATAGCCTTCTTTTG -3'

Sequencing Primer
(F):5'- ATGTCGTCCCAGTTGGTAAC -3'
(R):5'- GTGTCTTGATAGTTCGCCATG -3'
Posted On2016-09-01