Incidental Mutation 'R5424:Gas8'
ID426765
Institutional Source Beutler Lab
Gene Symbol Gas8
Ensembl Gene ENSMUSG00000040220
Gene Namegrowth arrest specific 8
SynonymsGas11
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123518834-123536650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123526512 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 200 (L200I)
Ref Sequence ENSEMBL: ENSMUSP00000148576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093043] [ENSMUST00000127664] [ENSMUST00000212923]
Predicted Effect probably benign
Transcript: ENSMUST00000093043
AA Change: L200I

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090730
Gene: ENSMUSG00000040220
AA Change: L200I

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
coiled coil region 26 105 N/A INTRINSIC
coiled coil region 164 199 N/A INTRINSIC
Pfam:GAS 221 420 1.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212809
Predicted Effect possibly damaging
Transcript: ENSMUST00000212923
AA Change: L200I

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene includes 11 exons spanning 25 kb and maps to a region of chromosome 16 that is sometimes deleted in breast and prostrate cancer. The second intron contains an apparently intronless gene, C16orf3, that is transcribed in the opposite orientation. This gene is a putative tumor suppressor gene. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit postnatal lethality, severe hydrocephaly, situs inversus with levocardia and abnormal cilia morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Gas8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Gas8 UTSW 8 123524106 missense probably damaging 1.00
R1552:Gas8 UTSW 8 123520646 missense probably benign 0.00
R2068:Gas8 UTSW 8 123526537 missense probably damaging 0.96
R4722:Gas8 UTSW 8 123525635 missense possibly damaging 0.88
R4840:Gas8 UTSW 8 123531014 missense probably benign 0.25
R6511:Gas8 UTSW 8 123524157 missense probably benign 0.00
R6520:Gas8 UTSW 8 123526474 missense probably benign 0.03
R7318:Gas8 UTSW 8 123530968 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCTGAATATGCCACTTGC -3'
(R):5'- TTCTAGAACACCCCACCGTG -3'

Sequencing Primer
(F):5'- TTGCAGGGAAAGCTCCAC -3'
(R):5'- AGCTCCTCTCCCAGAGC -3'
Posted On2016-09-01