Incidental Mutation 'R5424:Fchsd1'
ID426786
Institutional Source Beutler Lab
Gene Symbol Fchsd1
Ensembl Gene ENSMUSG00000038524
Gene NameFCH and double SH3 domains 1
SynonymsA030002D08Rik
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37957431-37969774 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 37959873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043437] [ENSMUST00000043498] [ENSMUST00000070709] [ENSMUST00000091932] [ENSMUST00000163128] [ENSMUST00000163591] [ENSMUST00000168056] [ENSMUST00000169360] [ENSMUST00000169498] [ENSMUST00000176104] [ENSMUST00000176902] [ENSMUST00000177058]
Predicted Effect probably benign
Transcript: ENSMUST00000043437
SMART Domains Protein: ENSMUSP00000047878
Gene: ENSMUSG00000038524

DomainStartEndE-ValueType
Pfam:FCH 21 100 1.6e-19 PFAM
coiled coil region 188 209 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
SH3 469 526 1.34e-8 SMART
SH3 547 606 1.94e-14 SMART
low complexity region 622 634 N/A INTRINSIC
low complexity region 657 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043498
SMART Domains Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 11 315 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070709
SMART Domains Protein: ENSMUSP00000070280
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091932
SMART Domains Protein: ENSMUSP00000089552
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 8.3e-23 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153945
Predicted Effect probably benign
Transcript: ENSMUST00000163128
SMART Domains Protein: ENSMUSP00000127234
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163591
SMART Domains Protein: ENSMUSP00000129299
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166727
Predicted Effect probably benign
Transcript: ENSMUST00000168056
SMART Domains Protein: ENSMUSP00000130051
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.9e-23 PFAM
low complexity region 104 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169360
SMART Domains Protein: ENSMUSP00000129880
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 4.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169498
SMART Domains Protein: ENSMUSP00000128949
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176104
SMART Domains Protein: ENSMUSP00000135556
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 60 3.3e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176902
SMART Domains Protein: ENSMUSP00000135176
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
low complexity region 103 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177058
SMART Domains Protein: ENSMUSP00000135615
Gene: ENSMUSG00000044024

DomainStartEndE-ValueType
Pfam:RELT 16 64 1.2e-22 PFAM
low complexity region 194 212 N/A INTRINSIC
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Fchsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Fchsd1 APN 18 37965893 intron probably benign
IGL01097:Fchsd1 APN 18 37967757 splice site probably null
IGL02069:Fchsd1 APN 18 37967614 nonsense probably null
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0015:Fchsd1 UTSW 18 37962959 missense probably benign 0.05
R0755:Fchsd1 UTSW 18 37968750 splice site probably null
R1524:Fchsd1 UTSW 18 37965897 critical splice donor site probably null
R2041:Fchsd1 UTSW 18 37967676 critical splice acceptor site probably null
R3820:Fchsd1 UTSW 18 37969457 splice site probably benign
R3821:Fchsd1 UTSW 18 37969457 splice site probably benign
R4998:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5017:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5018:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5022:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5023:Fchsd1 UTSW 18 37964810 missense possibly damaging 0.80
R5047:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5240:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5309:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5312:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5353:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5354:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5355:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5517:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5518:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5521:Fchsd1 UTSW 18 37966484 missense probably damaging 1.00
R5590:Fchsd1 UTSW 18 37961327 missense probably damaging 1.00
R5607:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5608:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5810:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5828:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5906:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5949:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5958:Fchsd1 UTSW 18 37959873 unclassified probably benign
R5969:Fchsd1 UTSW 18 37959873 unclassified probably benign
R6245:Fchsd1 UTSW 18 37962775 missense probably damaging 1.00
R6322:Fchsd1 UTSW 18 37965700 missense probably benign 0.00
R6433:Fchsd1 UTSW 18 37964084 missense possibly damaging 0.91
R6439:Fchsd1 UTSW 18 37969434 missense probably damaging 0.97
R6460:Fchsd1 UTSW 18 37959844 splice site probably null
R6488:Fchsd1 UTSW 18 37967268 intron probably null
R6650:Fchsd1 UTSW 18 37966502 nonsense probably null
X0024:Fchsd1 UTSW 18 37969391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTCTGTCTTAGGAATATCCCTGAC -3'
(R):5'- TCAATAGGCATTTTGAGGGGC -3'

Sequencing Primer
(F):5'- GTCTTAGGAATATCCCTGACAATTC -3'
(R):5'- TTTATAGCTTAGGCTGCTG -3'
Posted On2016-09-01