Incidental Mutation 'R5436:Larp4'
ID428386
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene NameLa ribonucleoprotein domain family, member 4
Synonyms
MMRRC Submission 043001-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5436 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99970065-100016358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99986114 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 78 (N78K)
Ref Sequence ENSEMBL: ENSMUSP00000155601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206] [ENSMUST00000230521] [ENSMUST00000230956] [ENSMUST00000231160]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057632
AA Change: N76K

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: N76K

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100206
AA Change: N77K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: N77K

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229891
Predicted Effect probably damaging
Transcript: ENSMUST00000230521
AA Change: N77K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000230956
AA Change: N78K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231160
AA Change: N18K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (106/107)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,764,499 K415N probably benign Het
4930449A18Rik T C 3: 59,846,693 noncoding transcript Het
Abca9 G A 11: 110,134,236 L994F probably damaging Het
Abl2 A T 1: 156,629,880 S239C probably damaging Het
Acsl5 T A 19: 55,279,565 probably null Het
Aff1 C T 5: 103,783,870 T126I probably damaging Het
Amtn T C 5: 88,381,626 L107P probably damaging Het
Ankrd45 A G 1: 161,159,112 probably benign Het
Arl6ip5 G A 6: 97,210,926 V36I probably damaging Het
Ascc3 T A 10: 50,658,983 D657E probably damaging Het
Ascl1 T A 10: 87,492,946 Q48L unknown Het
Asic4 T A 1: 75,451,319 V163E probably benign Het
Atm A T 9: 53,459,804 M2245K probably benign Het
Barx2 T G 9: 31,912,989 T35P probably damaging Het
BC027072 A T 17: 71,750,842 S613R probably damaging Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
C8b T A 4: 104,800,349 Y404* probably null Het
Car5a A G 8: 121,917,242 probably benign Het
Ccdc13 T C 9: 121,799,043 I169M probably benign Het
Cd163 A T 6: 124,327,964 D1100V probably benign Het
Cntfr T C 4: 41,663,322 N162D probably damaging Het
Cops3 T G 11: 59,824,345 D289A probably damaging Het
Crbn A T 6: 106,795,900 S42R probably damaging Het
Cth T A 3: 157,894,826 H397L probably benign Het
Dact2 A G 17: 14,195,748 L730P probably damaging Het
Dhx37 C T 5: 125,429,803 G210R probably benign Het
Dnah1 T C 14: 31,316,747 I126V probably benign Het
Dnttip2 T C 3: 122,278,769 I566T probably damaging Het
Ehbp1l1 G T 19: 5,716,248 R412S possibly damaging Het
Fam110b A C 4: 5,799,104 Q174P probably benign Het
Fam149a A T 8: 45,348,471 S457T probably benign Het
Fat3 A C 9: 15,960,514 V3527G probably benign Het
Fat4 A G 3: 38,891,346 M1463V probably benign Het
Gak T A 5: 108,592,352 I566F possibly damaging Het
Gdf10 T A 14: 33,932,256 I240N probably damaging Het
Gprc6a T A 10: 51,626,702 H355L probably benign Het
Gxylt1 T C 15: 93,247,899 K338R probably damaging Het
Hexim2 A T 11: 103,138,269 E49V probably null Het
Hfm1 T C 5: 106,892,772 D709G possibly damaging Het
Ighv1-49 T C 12: 115,055,461 K19R probably damaging Het
Il17a T A 1: 20,733,646 Y88* probably null Het
Iqsec1 A T 6: 90,845,361 probably benign Het
Itih2 T C 2: 10,105,196 D582G probably benign Het
Klc3 T C 7: 19,397,959 probably null Het
Larp4b A G 13: 9,168,900 D526G possibly damaging Het
Lexm A T 4: 106,610,493 H315Q probably benign Het
Limch1 T C 5: 66,974,566 V133A possibly damaging Het
Lmbr1l G A 15: 98,904,791 R426C probably damaging Het
Lox T A 18: 52,529,103 D76V probably benign Het
Lrrc8d T A 5: 105,812,552 I276N probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
March10 A T 11: 105,402,165 Y139N possibly damaging Het
Mrc1 T G 2: 14,266,515 I410S probably damaging Het
Mrto4 A T 4: 139,347,965 C176S probably damaging Het
Mtch1 G T 17: 29,347,590 D66E probably benign Het
Nbas T G 12: 13,374,811 L1017R probably damaging Het
Nim1k A G 13: 119,727,529 probably benign Het
Nlrp6 T A 7: 140,922,717 Y245* probably null Het
Olfr1264 T A 2: 90,021,665 M134L probably benign Het
Olfr192 C T 16: 59,098,819 V58I unknown Het
Olfr224 T A 11: 58,566,937 H136L probably benign Het
Olfr635 A T 7: 103,979,266 I25F probably benign Het
Olfr740 T G 14: 50,453,727 V225G probably damaging Het
Olfr906 A C 9: 38,488,539 D170A probably benign Het
Pcnx G T 12: 81,860,406 G12V probably damaging Het
Pdzd3 A G 9: 44,248,355 V448A possibly damaging Het
Pkp1 T A 1: 135,918,918 K32M probably damaging Het
Poc5 T C 13: 96,396,813 W150R probably damaging Het
Ppp1r16b T A 2: 158,757,333 probably benign Het
Prune2 T A 19: 17,020,643 M248K probably damaging Het
Rb1 A T 14: 73,213,140 probably null Het
Rhod A G 19: 4,426,587 C169R probably benign Het
Rif1 T C 2: 52,120,971 probably benign Het
Rnpc3 G A 3: 113,624,999 A100V probably damaging Het
Rsf1 GCGGC GCGGCGGCGTCGGC 7: 97,579,931 probably benign Het
Scnn1a A T 6: 125,343,022 D528V possibly damaging Het
Sdhaf3 C A 6: 7,038,855 T59K probably benign Het
Sec31a C A 5: 100,363,839 A330S probably damaging Het
Sgk3 A G 1: 9,881,872 D241G probably damaging Het
Skint6 T G 4: 113,096,591 I459L probably benign Het
Slco1a5 A T 6: 142,254,392 V222E probably damaging Het
Slit3 T A 11: 35,707,911 N1447K probably benign Het
Sorbs2 A G 8: 45,796,001 H628R probably damaging Het
St6galnac2 A G 11: 116,684,527 probably benign Het
Tbc1d31 T C 15: 57,952,871 V667A probably benign Het
Tbx20 A T 9: 24,769,720 Y159N probably damaging Het
Tmprss11b T A 5: 86,662,233 Q296L probably benign Het
Ttc6 T A 12: 57,674,594 probably null Het
Ttn T A 2: 76,870,899 probably benign Het
Tubgcp4 T A 2: 121,188,136 L340H probably damaging Het
Tubgcp4 T A 2: 121,194,182 F613I probably benign Het
Urb1 T C 16: 90,792,762 Y377C probably damaging Het
Utp15 G A 13: 98,260,846 probably null Het
Vstm2b A G 7: 40,901,283 probably null Het
Vwde A T 6: 13,190,628 V488D probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Zfp276 A T 8: 123,265,282 probably benign Het
Zfp318 T A 17: 46,413,049 S1993T possibly damaging Het
Zfp959 T C 17: 55,897,626 L218P probably benign Het
Zxdc A G 6: 90,370,560 D301G probably damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99987421 missense probably damaging 0.98
IGL01668:Larp4 APN 15 99987474 missense probably damaging 1.00
IGL01687:Larp4 APN 15 99996488 missense probably damaging 1.00
IGL02105:Larp4 APN 15 99986071 missense probably damaging 1.00
IGL02676:Larp4 APN 15 99990421 missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99986086 missense probably damaging 1.00
R1076:Larp4 UTSW 15 99997430 missense probably benign 0.00
R1996:Larp4 UTSW 15 99984963 missense probably damaging 1.00
R2183:Larp4 UTSW 15 100011897 missense probably benign 0.16
R2260:Larp4 UTSW 15 99997396 missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99990357 missense probably damaging 1.00
R3916:Larp4 UTSW 15 99990403 missense probably benign 0.00
R3962:Larp4 UTSW 15 100012145 missense probably damaging 1.00
R5059:Larp4 UTSW 15 100005290 missense probably damaging 1.00
R5081:Larp4 UTSW 15 99973017 intron probably benign
R5104:Larp4 UTSW 15 99986083 missense probably damaging 1.00
R5409:Larp4 UTSW 15 99986064 missense probably damaging 0.98
R6895:Larp4 UTSW 15 100007730 critical splice donor site probably null
R7316:Larp4 UTSW 15 100001017 missense probably benign
R7483:Larp4 UTSW 15 99991778 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGACATTAACTTAAGCCATTGGAC -3'
(R):5'- CCTAACACTTGTTTGACATAAGCTTC -3'

Sequencing Primer
(F):5'- AAGCCATTGGACTTTTCCCCAAC -3'
(R):5'- CACTTGTTTGACATAAGCTTCTTTTC -3'
Posted On2016-09-01