Incidental Mutation 'R5367:Pdlim7'
ID429432
Institutional Source Beutler Lab
Gene Symbol Pdlim7
Ensembl Gene ENSMUSG00000021493
Gene NamePDZ and LIM domain 7
SynonymsEnigma, 2410002J21Rik, 1110003B01Rik
MMRRC Submission 042945-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.818) question?
Stock #R5367 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55495795-55513676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 55506162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 214 (T214S)
Ref Sequence ENSEMBL: ENSMUSP00000120465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046246] [ENSMUST00000069929] [ENSMUST00000069968] [ENSMUST00000131306] [ENSMUST00000144288] [ENSMUST00000153426] [ENSMUST00000155098]
Predicted Effect probably benign
Transcript: ENSMUST00000046246
AA Change: T214S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047173
Gene: ENSMUSG00000021493
AA Change: T214S

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
low complexity region 209 223 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
LIM 281 332 3.69e-18 SMART
LIM 340 391 8.29e-21 SMART
LIM 399 452 2.47e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069929
SMART Domains Protein: ENSMUSP00000064219
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069968
SMART Domains Protein: ENSMUSP00000070153
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128911
Predicted Effect probably benign
Transcript: ENSMUST00000131306
SMART Domains Protein: ENSMUSP00000119753
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136583
Predicted Effect probably benign
Transcript: ENSMUST00000144288
SMART Domains Protein: ENSMUSP00000121614
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153230
Predicted Effect probably benign
Transcript: ENSMUST00000153426
SMART Domains Protein: ENSMUSP00000118867
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
Pfam:PDZ 3 58 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155098
AA Change: T214S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120465
Gene: ENSMUSG00000021493
AA Change: T214S

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
low complexity region 209 223 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
LIM 281 332 3.69e-18 SMART
LIM 340 391 8.29e-21 SMART
LIM 399 452 2.47e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184300
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is representative of a family of proteins composed of conserved PDZ and LIM domains. LIM domains are proposed to function in protein-protein recognition in a variety of contexts including gene transcription and development and in cytoskeletal interaction. The LIM domains of this protein bind to protein kinases, whereas the PDZ domain binds to actin filaments. The gene product is involved in the assembly of an actin filament-associated complex essential for transmission of ret/ptc2 mitogenic signaling. The biological function is likely to be that of an adapter, with the PDZ domain localizing the LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit heart defects and hemostatic dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T C 3: 60,039,636 Y252H probably damaging Het
Aadat T C 8: 60,526,596 I164T probably damaging Het
Adam11 A G 11: 102,773,653 H389R probably benign Het
Alkbh5 G T 11: 60,538,703 R94L possibly damaging Het
Ampd3 A G 7: 110,807,871 K644R possibly damaging Het
Ankhd1 T A 18: 36,589,408 L328H probably damaging Het
Ankrd55 G T 13: 112,318,502 V45F probably damaging Het
Apol7c C A 15: 77,526,147 V200F probably damaging Het
Arap1 G A 7: 101,409,130 V721M probably damaging Het
Arhgef40 A G 14: 51,989,699 D400G probably damaging Het
Bmp4 G T 14: 46,384,493 T198K possibly damaging Het
Cblb T A 16: 52,204,653 F970L probably damaging Het
Celf5 A G 10: 81,467,264 S148P probably damaging Het
Ckap5 T A 2: 91,615,141 C1708S possibly damaging Het
Clec2l T C 6: 38,677,524 F147L possibly damaging Het
Cnksr1 T A 4: 134,230,214 I465F possibly damaging Het
Coq10b A G 1: 55,052,984 D37G probably benign Het
Cpq T G 15: 33,213,104 Y90D possibly damaging Het
Depdc1a G A 3: 159,523,954 probably null Het
Eif2ak4 T A 2: 118,436,158 probably null Het
Eif3e C T 15: 43,252,304 M355I probably damaging Het
Eif4e1b G A 13: 54,786,944 V181M probably damaging Het
Erap1 A G 13: 74,646,561 E113G probably damaging Het
Fads2 A G 19: 10,064,285 L438P probably damaging Het
Fbl T A 7: 28,175,050 V67E probably damaging Het
Gde1 A G 7: 118,705,406 L82P probably damaging Het
Gm10226 T C 17: 21,691,977 S40P possibly damaging Het
Gm10717 T G 9: 3,026,317 F205C probably damaging Het
Gm1988 T A 7: 39,173,780 noncoding transcript Het
Gm6728 T C 6: 136,486,504 noncoding transcript Het
Grb14 C T 2: 64,917,309 V369I probably benign Het
Jag1 T A 2: 137,085,094 Q915L possibly damaging Het
Kdm5d G A Y: 941,645 G1282D probably benign Het
Krt83 A T 15: 101,486,994 L407Q probably damaging Het
Mlf1 A T 3: 67,393,963 H118L probably damaging Het
Mmp10 G T 9: 7,505,602 C289F probably damaging Het
Mroh2a A T 1: 88,254,965 N1205I possibly damaging Het
Myo9a T A 9: 59,900,449 S2029T probably damaging Het
Nap1l4 A C 7: 143,534,298 S174R probably damaging Het
Nos3 A G 5: 24,371,944 T490A probably benign Het
Olfr1000 A T 2: 85,608,374 C179S probably damaging Het
Olfr102 T A 17: 37,314,256 I43F probably damaging Het
Olfr1277 T A 2: 111,269,890 Q159L possibly damaging Het
Olfr1459 G A 19: 13,146,501 L53F probably damaging Het
Olfr76 A G 19: 12,120,436 V80A possibly damaging Het
Piezo2 T C 18: 63,064,731 E1578G probably damaging Het
Ptcd1 T A 5: 145,147,905 probably benign Het
Sart3 C T 5: 113,759,216 probably null Het
Scara5 CG C 14: 65,759,662 probably null Het
Scrn2 A G 11: 97,033,127 D279G possibly damaging Het
Sh2d3c A G 2: 32,745,902 D94G probably damaging Het
Slc12a4 A T 8: 105,951,634 V309E probably damaging Het
Slc1a6 A G 10: 78,787,803 E12G probably damaging Het
Smarcal1 T C 1: 72,595,976 probably null Het
Smr3a T C 5: 88,008,038 probably benign Het
Stox2 A G 8: 47,203,225 I72T probably damaging Het
Tmem234 G T 4: 129,600,707 probably benign Het
Tmem35b A G 4: 127,124,473 Q20R possibly damaging Het
Tom1l2 G A 11: 60,241,808 H430Y probably benign Het
Tpo T C 12: 30,103,290 Y355C probably damaging Het
Tulp2 A G 7: 45,516,651 N122S possibly damaging Het
Washc2 T A 6: 116,259,150 L1194H probably damaging Het
Xbp1 T C 11: 5,521,910 V12A probably benign Het
Other mutations in Pdlim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:Pdlim7 UTSW 13 55504880 intron probably null
R1518:Pdlim7 UTSW 13 55508294 nonsense probably null
R1857:Pdlim7 UTSW 13 55506045 missense probably damaging 1.00
R1886:Pdlim7 UTSW 13 55506168 missense probably benign 0.34
R1887:Pdlim7 UTSW 13 55506168 missense probably benign 0.34
R5139:Pdlim7 UTSW 13 55507056 missense probably damaging 1.00
R5866:Pdlim7 UTSW 13 55498688 missense probably damaging 1.00
R5922:Pdlim7 UTSW 13 55508955 missense probably damaging 1.00
R6328:Pdlim7 UTSW 13 55508092 intron probably benign
R6787:Pdlim7 UTSW 13 55508997 missense probably damaging 1.00
R6980:Pdlim7 UTSW 13 55508228 missense probably benign 0.35
X0010:Pdlim7 UTSW 13 55508984 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCATACAGGAGTCTTGCCGTTG -3'
(R):5'- AGATCTTACAGCCAGGTGCC -3'

Sequencing Primer
(F):5'- AGTCTTGCCGTTGTTGCTGC -3'
(R):5'- TGCCCAGGACAGAAGCC -3'
Posted On2016-09-06