Incidental Mutation 'R6980:Pdlim7'
ID543791
Institutional Source Beutler Lab
Gene Symbol Pdlim7
Ensembl Gene ENSMUSG00000021493
Gene NamePDZ and LIM domain 7
SynonymsEnigma, 2410002J21Rik, 1110003B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R6980 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55495795-55513676 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55508228 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 126 (D126E)
Ref Sequence ENSEMBL: ENSMUSP00000119753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046246] [ENSMUST00000069929] [ENSMUST00000069968] [ENSMUST00000131306] [ENSMUST00000144288] [ENSMUST00000153426] [ENSMUST00000155098]
Predicted Effect probably benign
Transcript: ENSMUST00000046246
AA Change: D126E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047173
Gene: ENSMUSG00000021493
AA Change: D126E

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
low complexity region 209 223 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
LIM 281 332 3.69e-18 SMART
LIM 340 391 8.29e-21 SMART
LIM 399 452 2.47e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069929
SMART Domains Protein: ENSMUSP00000064219
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069968
AA Change: D126E

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070153
Gene: ENSMUSG00000021493
AA Change: D126E

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131306
AA Change: D126E

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119753
Gene: ENSMUSG00000021493
AA Change: D126E

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144288
SMART Domains Protein: ENSMUSP00000121614
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153426
SMART Domains Protein: ENSMUSP00000118867
Gene: ENSMUSG00000021493

DomainStartEndE-ValueType
Pfam:PDZ 3 58 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155098
AA Change: D126E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120465
Gene: ENSMUSG00000021493
AA Change: D126E

DomainStartEndE-ValueType
PDZ 12 85 3.74e-14 SMART
low complexity region 209 223 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
LIM 281 332 3.69e-18 SMART
LIM 340 391 8.29e-21 SMART
LIM 399 452 2.47e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is representative of a family of proteins composed of conserved PDZ and LIM domains. LIM domains are proposed to function in protein-protein recognition in a variety of contexts including gene transcription and development and in cytoskeletal interaction. The LIM domains of this protein bind to protein kinases, whereas the PDZ domain binds to actin filaments. The gene product is involved in the assembly of an actin filament-associated complex essential for transmission of ret/ptc2 mitogenic signaling. The biological function is likely to be that of an adapter, with the PDZ domain localizing the LIM-binding proteins to actin filaments of both skeletal muscle and nonmuscle tissues. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit heart defects and hemostatic dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C A 2: 25,440,866 R1189S possibly damaging Het
Abcf2 T C 5: 24,565,972 Q594R probably benign Het
Abhd18 G A 3: 40,933,780 S353N probably benign Het
Adrb1 G T 19: 56,723,614 A415S probably benign Het
Art2b T C 7: 101,580,473 N73S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,139 probably benign Het
BC028528 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT 3: 95,888,168 probably benign Het
Cacna1a A G 8: 84,612,285 M1753V possibly damaging Het
Cbx8 A T 11: 119,039,461 I102N possibly damaging Het
Ccdc178 T A 18: 22,105,563 E332D probably benign Het
Cfap74 G A 4: 155,466,352 probably benign Het
Chat A T 14: 32,424,154 M354K probably benign Het
Cmas A G 6: 142,756,800 T10A probably damaging Het
Cyb561d1 A T 3: 108,200,159 L51H probably benign Het
D030056L22Rik A T 19: 18,717,265 N128I probably damaging Het
D130043K22Rik G T 13: 24,864,781 A423S probably damaging Het
Dnah14 T C 1: 181,648,230 I1349T probably benign Het
Dnajb3 T G 1: 88,205,014 D222A probably damaging Het
Dtx1 T C 5: 120,681,357 E592G probably damaging Het
Dzank1 C T 2: 144,490,136 G427R possibly damaging Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Eif4e1b T A 13: 54,784,103 probably null Het
Ell2 A G 13: 75,756,376 M159V probably null Het
Eml4 G A 17: 83,451,017 V377I probably benign Het
Fryl A T 5: 73,050,430 S2466T probably benign Het
Gfpt1 C A 6: 87,077,089 T426K probably damaging Het
Gm28710 T A 5: 16,826,946 V533D possibly damaging Het
Gm49355 T C 14: 12,307,173 probably benign Het
Gm5114 T C 7: 39,409,200 I332V probably benign Het
Gpr15 T A 16: 58,718,742 probably benign Het
Gpr179 T C 11: 97,334,858 E2157G probably benign Het
Gramd4 A G 15: 86,131,969 N482S probably benign Het
Hfm1 A T 5: 106,880,477 I829K probably benign Het
Hydin A T 8: 110,413,284 E728D possibly damaging Het
Ifngr2 T A 16: 91,560,007 V143E probably damaging Het
Ift172 T C 5: 31,257,386 D1390G probably benign Het
Kdf1 A T 4: 133,528,827 D285V probably damaging Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mdn1 G A 4: 32,726,942 probably null Het
Megf11 A G 9: 64,705,850 E1016G probably damaging Het
Mixl1 G A 1: 180,696,888 A42V possibly damaging Het
Mpp2 A G 11: 102,059,328 W567R probably damaging Het
Mrgpra6 A G 7: 47,188,949 L136P probably damaging Het
Mroh7 T A 4: 106,700,237 I759L probably benign Het
Nrxn2 A G 19: 6,450,579 D277G probably benign Het
Nup210l A T 3: 90,119,927 K205N probably benign Het
Olfr1040 A T 2: 86,146,337 Y132* probably null Het
Olfr1284 A G 2: 111,379,275 I92V possibly damaging Het
Olfr475-ps1 A G 2: 88,623,595 *97W probably null Het
Olfr603 T C 7: 103,383,096 E302G probably benign Het
Oxnad1 C T 14: 32,085,619 probably benign Het
Pamr1 C T 2: 102,642,204 T616I probably benign Het
Pcdhgb5 C T 18: 37,733,539 H796Y possibly damaging Het
Pfdn2 C T 1: 171,357,897 probably benign Het
Piezo2 T A 18: 63,082,961 probably null Het
Pms2 A T 5: 143,912,024 I43L probably benign Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Ptpn4 T A 1: 119,743,421 E202D possibly damaging Het
Rnf40 T A 7: 127,594,677 V455E probably damaging Het
Rp1l1 A G 14: 64,028,720 N585S probably benign Het
Rrp12 A G 19: 41,890,143 S188P probably damaging Het
Rsbn1l T A 5: 20,896,484 H686L probably benign Het
Runx2 C T 17: 44,735,316 V107I possibly damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Ryr1 T A 7: 29,109,387 D420V probably benign Het
Sash1 T C 10: 8,729,848 Q926R probably benign Het
Scgb3a2 T A 18: 43,764,434 I6N probably damaging Het
Sdc3 T A 4: 130,816,922 probably benign Het
Sik2 A G 9: 50,897,455 V658A probably benign Het
Slc25a39 A G 11: 102,405,775 V81A probably damaging Het
Snai2 T A 16: 14,708,249 S255T possibly damaging Het
Sorbs1 A T 19: 40,327,616 Y371* probably null Het
Spata31d1b A T 13: 59,715,422 H128L probably benign Het
Spdl1 A T 11: 34,830,879 M1K probably null Het
Tgm3 T A 2: 130,026,777 N211K probably benign Het
Tmem116 T C 5: 121,467,987 probably null Het
Tmem132e T A 11: 82,438,386 probably null Het
Tmem53 T C 4: 117,268,508 C251R probably damaging Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Trp63 T A 16: 25,802,093 F12I probably benign Het
Ttn C T 2: 76,879,057 probably null Het
Tubgcp4 T C 2: 121,195,465 V596A probably benign Het
Ugt2a3 A C 5: 87,325,632 H475Q probably damaging Het
Unc79 G A 12: 103,059,500 R382K probably damaging Het
Vmn2r58 T C 7: 41,864,238 H327R possibly damaging Het
Vmn2r7 G A 3: 64,716,566 T111I possibly damaging Het
Zfp318 T A 17: 46,397,212 Y399N probably damaging Het
Other mutations in Pdlim7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:Pdlim7 UTSW 13 55504880 intron probably null
R1518:Pdlim7 UTSW 13 55508294 nonsense probably null
R1857:Pdlim7 UTSW 13 55506045 missense probably damaging 1.00
R1886:Pdlim7 UTSW 13 55506168 missense probably benign 0.34
R1887:Pdlim7 UTSW 13 55506168 missense probably benign 0.34
R5139:Pdlim7 UTSW 13 55507056 missense probably damaging 1.00
R5367:Pdlim7 UTSW 13 55506162 missense probably benign 0.01
R5866:Pdlim7 UTSW 13 55498688 missense probably damaging 1.00
R5922:Pdlim7 UTSW 13 55508955 missense probably damaging 1.00
R6328:Pdlim7 UTSW 13 55508092 intron probably benign
R6787:Pdlim7 UTSW 13 55508997 missense probably damaging 1.00
X0010:Pdlim7 UTSW 13 55508984 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTTTGTGAGACTCAGCTGGC -3'
(R):5'- GGACCTGTCACTGTTCTTGG -3'

Sequencing Primer
(F):5'- CTGTGGAAGAGCAGTAGCCC -3'
(R):5'- ACCTGTCACTGTTCTTGGTGGTG -3'
Posted On2019-05-13